Incidental Mutation 'R1488:Bdh2'
ID165484
Institutional Source Beutler Lab
Gene Symbol Bdh2
Ensembl Gene ENSMUSG00000028167
Gene Name3-hydroxybutyrate dehydrogenase, type 2
SynonymsDhrs6, 1810026B04Rik
MMRRC Submission 039540-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1488 (G1)
Quality Score210
Status Validated
Chromosome3
Chromosomal Location135281221-135304426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135296841 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 157 (Y157C)
Ref Sequence ENSEMBL: ENSMUSP00000112683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029817] [ENSMUST00000120397]
Predicted Effect probably damaging
Transcript: ENSMUST00000029817
AA Change: Y147C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029817
Gene: ENSMUSG00000028167
AA Change: Y147C

DomainStartEndE-ValueType
Pfam:adh_short 7 166 2.2e-26 PFAM
Pfam:KR 7 169 5.1e-7 PFAM
Pfam:adh_short_C2 12 244 6.6e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120397
AA Change: Y157C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112683
Gene: ENSMUSG00000028167
AA Change: Y157C

DomainStartEndE-ValueType
Pfam:adh_short 7 166 2.2e-26 PFAM
Pfam:KR 7 169 5.1e-7 PFAM
Pfam:adh_short_C2 12 244 6.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154869
Predicted Effect probably damaging
Transcript: ENSMUST00000171974
AA Change: Y157C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131111
Gene: ENSMUSG00000028167
AA Change: Y157C

DomainStartEndE-ValueType
Pfam:KR 17 178 2.9e-8 PFAM
Pfam:adh_short 17 203 1.2e-51 PFAM
Pfam:adh_short_C2 22 254 1.6e-29 PFAM
Meta Mutation Damage Score 0.9734 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,933,447 N691S possibly damaging Het
Arhgap23 A G 11: 97,500,859 S1401G possibly damaging Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atg4c T A 4: 99,221,242 W149R probably damaging Het
Atxn1l A G 8: 109,733,417 I71T probably benign Het
Axdnd1 T A 1: 156,348,960 L748F probably damaging Het
C2cd4a G T 9: 67,831,708 R18S probably benign Het
Catsperb A G 12: 101,594,267 H839R probably damaging Het
Ccdc24 C A 4: 117,870,568 S134I possibly damaging Het
Cd55 G T 1: 130,448,378 T70K probably damaging Het
Cdh10 A T 15: 19,013,263 I650F probably damaging Het
Clca2 T A 3: 145,084,164 K470N possibly damaging Het
Csn2 G A 5: 87,694,896 Q91* probably null Het
Ctsh G A 9: 90,071,891 D218N possibly damaging Het
Cyb5r4 C G 9: 87,029,538 Y88* probably null Het
Dgkq A G 5: 108,650,877 F601S probably damaging Het
Eci2 A G 13: 34,977,933 V352A probably benign Het
Krt28 T C 11: 99,365,171 T421A probably benign Het
Lamp5 T C 2: 136,069,091 V248A probably benign Het
Lin9 T A 1: 180,688,285 L483Q possibly damaging Het
Lrp1b C A 2: 41,502,024 M509I probably benign Het
Lrrfip1 T C 1: 91,114,632 V253A probably damaging Het
Mpdz C A 4: 81,348,708 E981* probably null Het
Mpo A C 11: 87,797,430 N305T probably damaging Het
Olfr1385 A G 11: 49,495,118 E195G probably benign Het
Olfr507 A T 7: 108,622,489 I226F probably damaging Het
Olfr645 T C 7: 104,084,652 I143V probably benign Het
Papss2 T C 19: 32,637,090 S69P probably benign Het
Pcdhb22 A G 18: 37,519,888 T470A possibly damaging Het
Plce1 A G 19: 38,716,803 D884G possibly damaging Het
Prex2 T A 1: 11,193,528 I1239K probably benign Het
Prkd2 T A 7: 16,858,439 F625I probably damaging Het
Rab20 A T 8: 11,454,268 V144E probably benign Het
Rnf213 A G 11: 119,480,889 N4840S probably benign Het
Scaf8 T G 17: 3,197,597 M1065R probably damaging Het
Slco3a1 A G 7: 74,346,701 L319P possibly damaging Het
Slit1 A G 19: 41,608,385 C1092R probably damaging Het
Tlr4 A G 4: 66,839,549 D193G probably damaging Het
Tmem145 T A 7: 25,307,435 probably null Het
Tmem184a T A 5: 139,807,640 K235N probably benign Het
Tnpo1 A T 13: 98,856,907 D590E probably damaging Het
Trio C A 15: 27,740,967 G2724V probably damaging Het
Ttc6 A T 12: 57,649,515 Y34F possibly damaging Het
Tuba4a T C 1: 75,216,401 T190A probably benign Het
Tubgcp4 T G 2: 121,176,550 V136G possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r74 T C 7: 11,847,583 I270T probably benign Het
Vmn2r103 A T 17: 19,793,660 E238V probably damaging Het
Vmn2r60 T A 7: 42,136,713 F313L probably benign Het
Zfp710 T C 7: 80,082,004 Y310H probably damaging Het
Other mutations in Bdh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01844:Bdh2 APN 3 135288319 missense probably benign 0.13
R0684:Bdh2 UTSW 3 135291013 missense probably benign 0.01
R1398:Bdh2 UTSW 3 135295296 critical splice donor site probably benign
R1688:Bdh2 UTSW 3 135301638 missense possibly damaging 0.77
R1968:Bdh2 UTSW 3 135285609 missense probably benign 0.12
R1969:Bdh2 UTSW 3 135288279 missense probably damaging 1.00
R2192:Bdh2 UTSW 3 135295264 missense probably damaging 1.00
R5550:Bdh2 UTSW 3 135288313 missense probably benign 0.02
R6749:Bdh2 UTSW 3 135300691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCAAATTAGGTTCCGCGACAC -3'
(R):5'- CGATGTCTGTCAGTGGTGGAAAGC -3'

Sequencing Primer
(F):5'- CTCTATCCCTATTATAGGAGGAGACC -3'
(R):5'- CTGTCAGTGGTGGAAAGCAATATG -3'
Posted On2014-03-28