Incidental Mutation 'R1488:Vmn1r74'
ID165496
Institutional Source Beutler Lab
Gene Symbol Vmn1r74
Ensembl Gene ENSMUSG00000047655
Gene Namevomeronasal 1 receptor 74
SynonymsV1rg5
MMRRC Submission 039540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1488 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location11833980-11853276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11847583 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 270 (I270T)
Ref Sequence ENSEMBL: ENSMUSP00000154746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050416] [ENSMUST00000228471]
Predicted Effect probably benign
Transcript: ENSMUST00000050416
AA Change: I270T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000055148
Gene: ENSMUSG00000047655
AA Change: I270T

DomainStartEndE-ValueType
Pfam:7tm_1 22 290 1.3e-7 PFAM
Pfam:V1R 34 296 1.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210930
Predicted Effect probably benign
Transcript: ENSMUST00000228471
AA Change: I270T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,933,447 N691S possibly damaging Het
Arhgap23 A G 11: 97,500,859 S1401G possibly damaging Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atg4c T A 4: 99,221,242 W149R probably damaging Het
Atxn1l A G 8: 109,733,417 I71T probably benign Het
Axdnd1 T A 1: 156,348,960 L748F probably damaging Het
Bdh2 A G 3: 135,296,841 Y157C probably damaging Het
C2cd4a G T 9: 67,831,708 R18S probably benign Het
Catsperb A G 12: 101,594,267 H839R probably damaging Het
Ccdc24 C A 4: 117,870,568 S134I possibly damaging Het
Cd55 G T 1: 130,448,378 T70K probably damaging Het
Cdh10 A T 15: 19,013,263 I650F probably damaging Het
Clca2 T A 3: 145,084,164 K470N possibly damaging Het
Csn2 G A 5: 87,694,896 Q91* probably null Het
Ctsh G A 9: 90,071,891 D218N possibly damaging Het
Cyb5r4 C G 9: 87,029,538 Y88* probably null Het
Dgkq A G 5: 108,650,877 F601S probably damaging Het
Eci2 A G 13: 34,977,933 V352A probably benign Het
Krt28 T C 11: 99,365,171 T421A probably benign Het
Lamp5 T C 2: 136,069,091 V248A probably benign Het
Lin9 T A 1: 180,688,285 L483Q possibly damaging Het
Lrp1b C A 2: 41,502,024 M509I probably benign Het
Lrrfip1 T C 1: 91,114,632 V253A probably damaging Het
Mpdz C A 4: 81,348,708 E981* probably null Het
Mpo A C 11: 87,797,430 N305T probably damaging Het
Olfr1385 A G 11: 49,495,118 E195G probably benign Het
Olfr507 A T 7: 108,622,489 I226F probably damaging Het
Olfr645 T C 7: 104,084,652 I143V probably benign Het
Papss2 T C 19: 32,637,090 S69P probably benign Het
Pcdhb22 A G 18: 37,519,888 T470A possibly damaging Het
Plce1 A G 19: 38,716,803 D884G possibly damaging Het
Prex2 T A 1: 11,193,528 I1239K probably benign Het
Prkd2 T A 7: 16,858,439 F625I probably damaging Het
Rab20 A T 8: 11,454,268 V144E probably benign Het
Rnf213 A G 11: 119,480,889 N4840S probably benign Het
Scaf8 T G 17: 3,197,597 M1065R probably damaging Het
Slco3a1 A G 7: 74,346,701 L319P possibly damaging Het
Slit1 A G 19: 41,608,385 C1092R probably damaging Het
Tlr4 A G 4: 66,839,549 D193G probably damaging Het
Tmem145 T A 7: 25,307,435 probably null Het
Tmem184a T A 5: 139,807,640 K235N probably benign Het
Tnpo1 A T 13: 98,856,907 D590E probably damaging Het
Trio C A 15: 27,740,967 G2724V probably damaging Het
Ttc6 A T 12: 57,649,515 Y34F possibly damaging Het
Tuba4a T C 1: 75,216,401 T190A probably benign Het
Tubgcp4 T G 2: 121,176,550 V136G possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r103 A T 17: 19,793,660 E238V probably damaging Het
Vmn2r60 T A 7: 42,136,713 F313L probably benign Het
Zfp710 T C 7: 80,082,004 Y310H probably damaging Het
Other mutations in Vmn1r74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Vmn1r74 APN 7 11847633 missense probably damaging 0.98
IGL01673:Vmn1r74 APN 7 11847390 missense possibly damaging 0.94
IGL03023:Vmn1r74 APN 7 11847330 missense possibly damaging 0.46
IGL03409:Vmn1r74 APN 7 11847313 missense probably damaging 0.99
R0393:Vmn1r74 UTSW 7 11847315 missense possibly damaging 0.79
R1707:Vmn1r74 UTSW 7 11847577 missense probably damaging 0.98
R1998:Vmn1r74 UTSW 7 11847375 missense probably damaging 1.00
R1999:Vmn1r74 UTSW 7 11847375 missense probably damaging 1.00
R2139:Vmn1r74 UTSW 7 11847316 missense probably damaging 1.00
R4027:Vmn1r74 UTSW 7 11846971 missense probably damaging 0.98
R4576:Vmn1r74 UTSW 7 11846769 unclassified probably null
R4619:Vmn1r74 UTSW 7 11847471 missense possibly damaging 0.61
R4619:Vmn1r74 UTSW 7 11847476 missense probably damaging 1.00
R5371:Vmn1r74 UTSW 7 11847057 missense probably damaging 1.00
R5606:Vmn1r74 UTSW 7 11846895 missense probably benign 0.01
R6464:Vmn1r74 UTSW 7 11847204 missense possibly damaging 0.87
R6901:Vmn1r74 UTSW 7 11847441 missense probably benign 0.00
R6920:Vmn1r74 UTSW 7 11847648 missense probably benign 0.01
R7223:Vmn1r74 UTSW 7 11846967 nonsense probably null
R7231:Vmn1r74 UTSW 7 11846961 missense probably benign 0.34
R7418:Vmn1r74 UTSW 7 11847154 missense possibly damaging 0.88
RF049:Vmn1r74 UTSW 7 11847140 frame shift probably null
RF063:Vmn1r74 UTSW 7 11847140 frame shift probably null
Z1176:Vmn1r74 UTSW 7 11847009 missense not run
Predicted Primers PCR Primer
(F):5'- GGTCTCATGGCCTATTCAAGTGTCTC -3'
(R):5'- GTCATAGCATTGCACAACAGATAACAGC -3'

Sequencing Primer
(F):5'- TTCTCTACAGACATAAGAAACAAGTC -3'
(R):5'- TTGCACAACAGATAACAGCATACAC -3'
Posted On2014-03-28