Incidental Mutation 'R1488:Olfr507'
ID165504
Institutional Source Beutler Lab
Gene Symbol Olfr507
Ensembl Gene ENSMUSG00000061000
Gene Nameolfactory receptor 507
SynonymsGA_x6K02T2PBJ9-10951546-10952496, MOR204-7
MMRRC Submission 039540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R1488 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108621814-108622764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108622489 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 226 (I226F)
Ref Sequence ENSEMBL: ENSMUSP00000078926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080014]
Predicted Effect probably damaging
Transcript: ENSMUST00000080014
AA Change: I226F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078926
Gene: ENSMUSG00000061000
AA Change: I226F

DomainStartEndE-ValueType
Pfam:7tm_4 34 313 6.1e-52 PFAM
Pfam:7tm_1 44 295 1e-20 PFAM
Meta Mutation Damage Score 0.2215 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,933,447 N691S possibly damaging Het
Arhgap23 A G 11: 97,500,859 S1401G possibly damaging Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atg4c T A 4: 99,221,242 W149R probably damaging Het
Atxn1l A G 8: 109,733,417 I71T probably benign Het
Axdnd1 T A 1: 156,348,960 L748F probably damaging Het
Bdh2 A G 3: 135,296,841 Y157C probably damaging Het
C2cd4a G T 9: 67,831,708 R18S probably benign Het
Catsperb A G 12: 101,594,267 H839R probably damaging Het
Ccdc24 C A 4: 117,870,568 S134I possibly damaging Het
Cd55 G T 1: 130,448,378 T70K probably damaging Het
Cdh10 A T 15: 19,013,263 I650F probably damaging Het
Clca2 T A 3: 145,084,164 K470N possibly damaging Het
Csn2 G A 5: 87,694,896 Q91* probably null Het
Ctsh G A 9: 90,071,891 D218N possibly damaging Het
Cyb5r4 C G 9: 87,029,538 Y88* probably null Het
Dgkq A G 5: 108,650,877 F601S probably damaging Het
Eci2 A G 13: 34,977,933 V352A probably benign Het
Krt28 T C 11: 99,365,171 T421A probably benign Het
Lamp5 T C 2: 136,069,091 V248A probably benign Het
Lin9 T A 1: 180,688,285 L483Q possibly damaging Het
Lrp1b C A 2: 41,502,024 M509I probably benign Het
Lrrfip1 T C 1: 91,114,632 V253A probably damaging Het
Mpdz C A 4: 81,348,708 E981* probably null Het
Mpo A C 11: 87,797,430 N305T probably damaging Het
Olfr1385 A G 11: 49,495,118 E195G probably benign Het
Olfr645 T C 7: 104,084,652 I143V probably benign Het
Papss2 T C 19: 32,637,090 S69P probably benign Het
Pcdhb22 A G 18: 37,519,888 T470A possibly damaging Het
Plce1 A G 19: 38,716,803 D884G possibly damaging Het
Prex2 T A 1: 11,193,528 I1239K probably benign Het
Prkd2 T A 7: 16,858,439 F625I probably damaging Het
Rab20 A T 8: 11,454,268 V144E probably benign Het
Rnf213 A G 11: 119,480,889 N4840S probably benign Het
Scaf8 T G 17: 3,197,597 M1065R probably damaging Het
Slco3a1 A G 7: 74,346,701 L319P possibly damaging Het
Slit1 A G 19: 41,608,385 C1092R probably damaging Het
Tlr4 A G 4: 66,839,549 D193G probably damaging Het
Tmem145 T A 7: 25,307,435 probably null Het
Tmem184a T A 5: 139,807,640 K235N probably benign Het
Tnpo1 A T 13: 98,856,907 D590E probably damaging Het
Trio C A 15: 27,740,967 G2724V probably damaging Het
Ttc6 A T 12: 57,649,515 Y34F possibly damaging Het
Tuba4a T C 1: 75,216,401 T190A probably benign Het
Tubgcp4 T G 2: 121,176,550 V136G possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r74 T C 7: 11,847,583 I270T probably benign Het
Vmn2r103 A T 17: 19,793,660 E238V probably damaging Het
Vmn2r60 T A 7: 42,136,713 F313L probably benign Het
Zfp710 T C 7: 80,082,004 Y310H probably damaging Het
Other mutations in Olfr507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Olfr507 APN 7 108621857 missense probably damaging 1.00
IGL01979:Olfr507 APN 7 108622441 missense probably benign 0.09
IGL02373:Olfr507 APN 7 108622103 missense probably benign 0.11
IGL02754:Olfr507 APN 7 108622673 missense possibly damaging 0.94
IGL03008:Olfr507 APN 7 108622283 missense probably damaging 0.99
R0305:Olfr507 UTSW 7 108622585 missense probably benign 0.01
R0584:Olfr507 UTSW 7 108622415 missense probably benign 0.00
R0611:Olfr507 UTSW 7 108622287 missense possibly damaging 0.72
R0947:Olfr507 UTSW 7 108622672 missense probably benign 0.02
R1808:Olfr507 UTSW 7 108622610 missense possibly damaging 0.87
R3763:Olfr507 UTSW 7 108622717 missense probably damaging 1.00
R4367:Olfr507 UTSW 7 108621889 missense probably benign 0.27
R4369:Olfr507 UTSW 7 108621889 missense probably benign 0.27
R4371:Olfr507 UTSW 7 108621889 missense probably benign 0.27
R4609:Olfr507 UTSW 7 108622504 missense probably benign 0.35
R5389:Olfr507 UTSW 7 108622717 missense probably damaging 1.00
R6499:Olfr507 UTSW 7 108622506 missense probably benign 0.02
R6684:Olfr507 UTSW 7 108621934 missense probably damaging 0.98
R7531:Olfr507 UTSW 7 108622062 missense probably benign 0.06
R7555:Olfr507 UTSW 7 108622726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTTCCTGCTGGAGAGAAGCAC -3'
(R):5'- GGTTCAACATGGGGATTGCTATCGC -3'

Sequencing Primer
(F):5'- ACACAAGTCTGTATCCAGTTGC -3'
(R):5'- GCTATCGCTATCATGTAAAACACAG -3'
Posted On2014-03-28