Incidental Mutation 'R1488:Ctsh'
ID165509
Institutional Source Beutler Lab
Gene Symbol Ctsh
Ensembl Gene ENSMUSG00000032359
Gene Namecathepsin H
SynonymsCat H
MMRRC Submission 039540-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1488 (G1)
Quality Score215
Status Validated
Chromosome9
Chromosomal Location90054152-90076089 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90071891 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 218 (D218N)
Ref Sequence ENSEMBL: ENSMUSP00000140437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034915] [ENSMUST00000123320] [ENSMUST00000185459]
Predicted Effect probably benign
Transcript: ENSMUST00000034915
AA Change: D256N

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034915
Gene: ENSMUSG00000032359
AA Change: D256N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Inhibitor_I29 33 88 7.24e-17 SMART
Pept_C1 114 330 7.46e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151219
Predicted Effect possibly damaging
Transcript: ENSMUST00000185459
AA Change: D218N

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140437
Gene: ENSMUSG00000032359
AA Change: D218N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Inhibitor_I29 30 85 5.3e-21 SMART
Pept_C1 85 291 9.4e-87 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190338
Meta Mutation Damage Score 0.4191 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the cathepsin H mini, heavy, and light chains. In rat and human, these three chains can associate to form the mature enzyme, which has both aminopeptidase and endopeptidase activities. Homozygous knockout mice for this gene exhibit impaired lung surfactant processing and reduced tumorigenesis in a pancreatic cancer model. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit impaired lung surfactant and an abnormal eye globe with elongated axial length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,933,447 N691S possibly damaging Het
Arhgap23 A G 11: 97,500,859 S1401G possibly damaging Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atg4c T A 4: 99,221,242 W149R probably damaging Het
Atxn1l A G 8: 109,733,417 I71T probably benign Het
Axdnd1 T A 1: 156,348,960 L748F probably damaging Het
Bdh2 A G 3: 135,296,841 Y157C probably damaging Het
C2cd4a G T 9: 67,831,708 R18S probably benign Het
Catsperb A G 12: 101,594,267 H839R probably damaging Het
Ccdc24 C A 4: 117,870,568 S134I possibly damaging Het
Cd55 G T 1: 130,448,378 T70K probably damaging Het
Cdh10 A T 15: 19,013,263 I650F probably damaging Het
Clca2 T A 3: 145,084,164 K470N possibly damaging Het
Csn2 G A 5: 87,694,896 Q91* probably null Het
Cyb5r4 C G 9: 87,029,538 Y88* probably null Het
Dgkq A G 5: 108,650,877 F601S probably damaging Het
Eci2 A G 13: 34,977,933 V352A probably benign Het
Krt28 T C 11: 99,365,171 T421A probably benign Het
Lamp5 T C 2: 136,069,091 V248A probably benign Het
Lin9 T A 1: 180,688,285 L483Q possibly damaging Het
Lrp1b C A 2: 41,502,024 M509I probably benign Het
Lrrfip1 T C 1: 91,114,632 V253A probably damaging Het
Mpdz C A 4: 81,348,708 E981* probably null Het
Mpo A C 11: 87,797,430 N305T probably damaging Het
Olfr1385 A G 11: 49,495,118 E195G probably benign Het
Olfr507 A T 7: 108,622,489 I226F probably damaging Het
Olfr645 T C 7: 104,084,652 I143V probably benign Het
Papss2 T C 19: 32,637,090 S69P probably benign Het
Pcdhb22 A G 18: 37,519,888 T470A possibly damaging Het
Plce1 A G 19: 38,716,803 D884G possibly damaging Het
Prex2 T A 1: 11,193,528 I1239K probably benign Het
Prkd2 T A 7: 16,858,439 F625I probably damaging Het
Rab20 A T 8: 11,454,268 V144E probably benign Het
Rnf213 A G 11: 119,480,889 N4840S probably benign Het
Scaf8 T G 17: 3,197,597 M1065R probably damaging Het
Slco3a1 A G 7: 74,346,701 L319P possibly damaging Het
Slit1 A G 19: 41,608,385 C1092R probably damaging Het
Tlr4 A G 4: 66,839,549 D193G probably damaging Het
Tmem145 T A 7: 25,307,435 probably null Het
Tmem184a T A 5: 139,807,640 K235N probably benign Het
Tnpo1 A T 13: 98,856,907 D590E probably damaging Het
Trio C A 15: 27,740,967 G2724V probably damaging Het
Ttc6 A T 12: 57,649,515 Y34F possibly damaging Het
Tuba4a T C 1: 75,216,401 T190A probably benign Het
Tubgcp4 T G 2: 121,176,550 V136G possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r74 T C 7: 11,847,583 I270T probably benign Het
Vmn2r103 A T 17: 19,793,660 E238V probably damaging Het
Vmn2r60 T A 7: 42,136,713 F313L probably benign Het
Zfp710 T C 7: 80,082,004 Y310H probably damaging Het
Other mutations in Ctsh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Ctsh APN 9 90064238 missense probably damaging 1.00
IGL01875:Ctsh APN 9 90064207 missense probably damaging 1.00
IGL02008:Ctsh APN 9 90061547 missense probably damaging 1.00
R0336:Ctsh UTSW 9 90075738 missense probably damaging 1.00
R0632:Ctsh UTSW 9 90061582 missense possibly damaging 0.82
R1847:Ctsh UTSW 9 90061565 missense probably benign 0.04
R3613:Ctsh UTSW 9 90075710 missense probably damaging 1.00
R4270:Ctsh UTSW 9 90061598 missense probably damaging 0.99
R4860:Ctsh UTSW 9 90054548 missense probably benign 0.01
R5187:Ctsh UTSW 9 90054590 missense probably damaging 1.00
R5469:Ctsh UTSW 9 90060511 critical splice donor site probably null
R5900:Ctsh UTSW 9 90064568 missense probably damaging 1.00
R5937:Ctsh UTSW 9 90061456 missense probably benign
R6303:Ctsh UTSW 9 90062743 missense possibly damaging 0.83
R6657:Ctsh UTSW 9 90060502 missense probably benign 0.30
R6905:Ctsh UTSW 9 90062766 missense probably damaging 1.00
R6985:Ctsh UTSW 9 90054604 missense possibly damaging 0.90
R7171:Ctsh UTSW 9 90067101 missense probably benign
R7342:Ctsh UTSW 9 90074987 missense probably benign
R7819:Ctsh UTSW 9 90060503 missense possibly damaging 0.71
R7884:Ctsh UTSW 9 90061423 missense probably benign
R7967:Ctsh UTSW 9 90061423 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTTGTTGTCCCTCAAGGTTACCTG -3'
(R):5'- AGACTTGGTCCCTGACACTCAGAG -3'

Sequencing Primer
(F):5'- AAGGTTACCTGCACAGCTCTG -3'
(R):5'- CCTGACACTCAGAGCTGAAGG -3'
Posted On2014-03-28