Incidental Mutation 'R1488:Mpo'
ID165511
Institutional Source Beutler Lab
Gene Symbol Mpo
Ensembl Gene ENSMUSG00000009350
Gene Namemyeloperoxidase
Synonyms
MMRRC Submission 039540-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1488 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87793581-87804413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 87797430 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 305 (N305T)
Ref Sequence ENSEMBL: ENSMUSP00000112837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020779] [ENSMUST00000107930] [ENSMUST00000121303] [ENSMUST00000143021]
Predicted Effect probably damaging
Transcript: ENSMUST00000020779
AA Change: N305T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020779
Gene: ENSMUSG00000009350
AA Change: N305T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:An_peroxidase 147 692 4.2e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107930
SMART Domains Protein: ENSMUSP00000103563
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
SCOP:g1cxp.1 82 99 1e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121303
AA Change: N305T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112837
Gene: ENSMUSG00000009350
AA Change: N305T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:An_peroxidase 147 692 4.2e-183 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130442
Predicted Effect probably benign
Transcript: ENSMUST00000143021
SMART Domains Protein: ENSMUSP00000123371
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:4C1M|B 139 167 4e-11 PDB
SCOP:g1cxp.1 141 167 4e-10 SMART
Meta Mutation Damage Score 0.9674 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myeloperoxidase (MPO) is a heme protein synthesized during myeloid differentiation that constitutes the major component of neutrophil azurophilic granules. Produced as a single chain precursor, myeloperoxidase is subsequently cleaved into a light and heavy chain. The mature myeloperoxidase is a tetramer composed of 2 light chains and 2 heavy chains. This enzyme produces hypohalous acids central to the microbicidal activity of neutrophils. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene causes neutrophil dysfunction and decreased resistance to fungal infection with Candida, and may lead to enhanced atherosclerosis, reduced neutrophil-mediated lysis of muscle cells, decreased resistance to EAE, and altered asbestos-induced lung inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,933,447 N691S possibly damaging Het
Arhgap23 A G 11: 97,500,859 S1401G possibly damaging Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atg4c T A 4: 99,221,242 W149R probably damaging Het
Atxn1l A G 8: 109,733,417 I71T probably benign Het
Axdnd1 T A 1: 156,348,960 L748F probably damaging Het
Bdh2 A G 3: 135,296,841 Y157C probably damaging Het
C2cd4a G T 9: 67,831,708 R18S probably benign Het
Catsperb A G 12: 101,594,267 H839R probably damaging Het
Ccdc24 C A 4: 117,870,568 S134I possibly damaging Het
Cd55 G T 1: 130,448,378 T70K probably damaging Het
Cdh10 A T 15: 19,013,263 I650F probably damaging Het
Clca2 T A 3: 145,084,164 K470N possibly damaging Het
Csn2 G A 5: 87,694,896 Q91* probably null Het
Ctsh G A 9: 90,071,891 D218N possibly damaging Het
Cyb5r4 C G 9: 87,029,538 Y88* probably null Het
Dgkq A G 5: 108,650,877 F601S probably damaging Het
Eci2 A G 13: 34,977,933 V352A probably benign Het
Krt28 T C 11: 99,365,171 T421A probably benign Het
Lamp5 T C 2: 136,069,091 V248A probably benign Het
Lin9 T A 1: 180,688,285 L483Q possibly damaging Het
Lrp1b C A 2: 41,502,024 M509I probably benign Het
Lrrfip1 T C 1: 91,114,632 V253A probably damaging Het
Mpdz C A 4: 81,348,708 E981* probably null Het
Olfr1385 A G 11: 49,495,118 E195G probably benign Het
Olfr507 A T 7: 108,622,489 I226F probably damaging Het
Olfr645 T C 7: 104,084,652 I143V probably benign Het
Papss2 T C 19: 32,637,090 S69P probably benign Het
Pcdhb22 A G 18: 37,519,888 T470A possibly damaging Het
Plce1 A G 19: 38,716,803 D884G possibly damaging Het
Prex2 T A 1: 11,193,528 I1239K probably benign Het
Prkd2 T A 7: 16,858,439 F625I probably damaging Het
Rab20 A T 8: 11,454,268 V144E probably benign Het
Rnf213 A G 11: 119,480,889 N4840S probably benign Het
Scaf8 T G 17: 3,197,597 M1065R probably damaging Het
Slco3a1 A G 7: 74,346,701 L319P possibly damaging Het
Slit1 A G 19: 41,608,385 C1092R probably damaging Het
Tlr4 A G 4: 66,839,549 D193G probably damaging Het
Tmem145 T A 7: 25,307,435 probably null Het
Tmem184a T A 5: 139,807,640 K235N probably benign Het
Tnpo1 A T 13: 98,856,907 D590E probably damaging Het
Trio C A 15: 27,740,967 G2724V probably damaging Het
Ttc6 A T 12: 57,649,515 Y34F possibly damaging Het
Tuba4a T C 1: 75,216,401 T190A probably benign Het
Tubgcp4 T G 2: 121,176,550 V136G possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r74 T C 7: 11,847,583 I270T probably benign Het
Vmn2r103 A T 17: 19,793,660 E238V probably damaging Het
Vmn2r60 T A 7: 42,136,713 F313L probably benign Het
Zfp710 T C 7: 80,082,004 Y310H probably damaging Het
Other mutations in Mpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Mpo APN 11 87802617 missense probably benign
IGL00668:Mpo APN 11 87797334 missense probably benign 0.01
IGL01016:Mpo APN 11 87797610 unclassified probably null
IGL01517:Mpo APN 11 87795821 missense possibly damaging 0.83
IGL01530:Mpo APN 11 87801191 missense probably benign 0.00
IGL02123:Mpo APN 11 87794795 missense probably benign 0.05
R0091:Mpo UTSW 11 87801610 missense probably benign 0.06
R0458:Mpo UTSW 11 87796297 missense probably benign 0.35
R0506:Mpo UTSW 11 87803504 missense probably benign 0.00
R0574:Mpo UTSW 11 87796076 missense probably damaging 0.99
R0850:Mpo UTSW 11 87797502 missense probably damaging 1.00
R1753:Mpo UTSW 11 87795881 missense probably benign 0.06
R1785:Mpo UTSW 11 87797361 missense possibly damaging 0.90
R1891:Mpo UTSW 11 87801280 nonsense probably null
R1989:Mpo UTSW 11 87803472 missense probably damaging 1.00
R2107:Mpo UTSW 11 87796075 missense probably damaging 1.00
R2108:Mpo UTSW 11 87796075 missense probably damaging 1.00
R2130:Mpo UTSW 11 87797361 missense possibly damaging 0.90
R2132:Mpo UTSW 11 87797361 missense possibly damaging 0.90
R3930:Mpo UTSW 11 87801040 missense probably damaging 1.00
R3931:Mpo UTSW 11 87801040 missense probably damaging 1.00
R3941:Mpo UTSW 11 87797349 missense probably benign 0.02
R4323:Mpo UTSW 11 87796039 missense probably damaging 1.00
R4857:Mpo UTSW 11 87796281 missense probably benign
R4892:Mpo UTSW 11 87802681 missense probably benign 0.00
R5224:Mpo UTSW 11 87796457 unclassified probably benign
R5250:Mpo UTSW 11 87803433 missense probably benign 0.03
R5373:Mpo UTSW 11 87803611 critical splice donor site probably null
R5374:Mpo UTSW 11 87803611 critical splice donor site probably null
R5408:Mpo UTSW 11 87801025 splice site probably null
R5708:Mpo UTSW 11 87801755 splice site probably null
R6354:Mpo UTSW 11 87797346 missense possibly damaging 0.89
R6598:Mpo UTSW 11 87799972 missense probably benign 0.43
R6713:Mpo UTSW 11 87795368 missense probably damaging 1.00
R7053:Mpo UTSW 11 87803510 missense probably damaging 0.99
R7395:Mpo UTSW 11 87801124 missense probably damaging 1.00
R7573:Mpo UTSW 11 87797577 missense probably benign 0.01
RF018:Mpo UTSW 11 87797639 missense probably damaging 1.00
Z1088:Mpo UTSW 11 87795245 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAGTTACAAATGCCCGCTCTCCCG -3'
(R):5'- CAAGCTGGAAACAGCTCTATGCCAC -3'

Sequencing Primer
(F):5'- CTCTCCCGACCCACAAAAG -3'
(R):5'- AAACAGCTCTATGCCACTCTAGTTC -3'
Posted On2014-03-28