Incidental Mutation 'R1488:Vmn2r103'
ID165522
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Namevomeronasal 2, receptor 103
SynonymsEG627636
MMRRC Submission 039540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1488 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19773363-19812536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19793660 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 238 (E238V)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
Predicted Effect probably damaging
Transcript: ENSMUST00000172203
AA Change: E238V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: E238V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,933,447 N691S possibly damaging Het
Arhgap23 A G 11: 97,500,859 S1401G possibly damaging Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atg4c T A 4: 99,221,242 W149R probably damaging Het
Atxn1l A G 8: 109,733,417 I71T probably benign Het
Axdnd1 T A 1: 156,348,960 L748F probably damaging Het
Bdh2 A G 3: 135,296,841 Y157C probably damaging Het
C2cd4a G T 9: 67,831,708 R18S probably benign Het
Catsperb A G 12: 101,594,267 H839R probably damaging Het
Ccdc24 C A 4: 117,870,568 S134I possibly damaging Het
Cd55 G T 1: 130,448,378 T70K probably damaging Het
Cdh10 A T 15: 19,013,263 I650F probably damaging Het
Clca2 T A 3: 145,084,164 K470N possibly damaging Het
Csn2 G A 5: 87,694,896 Q91* probably null Het
Ctsh G A 9: 90,071,891 D218N possibly damaging Het
Cyb5r4 C G 9: 87,029,538 Y88* probably null Het
Dgkq A G 5: 108,650,877 F601S probably damaging Het
Eci2 A G 13: 34,977,933 V352A probably benign Het
Krt28 T C 11: 99,365,171 T421A probably benign Het
Lamp5 T C 2: 136,069,091 V248A probably benign Het
Lin9 T A 1: 180,688,285 L483Q possibly damaging Het
Lrp1b C A 2: 41,502,024 M509I probably benign Het
Lrrfip1 T C 1: 91,114,632 V253A probably damaging Het
Mpdz C A 4: 81,348,708 E981* probably null Het
Mpo A C 11: 87,797,430 N305T probably damaging Het
Olfr1385 A G 11: 49,495,118 E195G probably benign Het
Olfr507 A T 7: 108,622,489 I226F probably damaging Het
Olfr645 T C 7: 104,084,652 I143V probably benign Het
Papss2 T C 19: 32,637,090 S69P probably benign Het
Pcdhb22 A G 18: 37,519,888 T470A possibly damaging Het
Plce1 A G 19: 38,716,803 D884G possibly damaging Het
Prex2 T A 1: 11,193,528 I1239K probably benign Het
Prkd2 T A 7: 16,858,439 F625I probably damaging Het
Rab20 A T 8: 11,454,268 V144E probably benign Het
Rnf213 A G 11: 119,480,889 N4840S probably benign Het
Scaf8 T G 17: 3,197,597 M1065R probably damaging Het
Slco3a1 A G 7: 74,346,701 L319P possibly damaging Het
Slit1 A G 19: 41,608,385 C1092R probably damaging Het
Tlr4 A G 4: 66,839,549 D193G probably damaging Het
Tmem145 T A 7: 25,307,435 probably null Het
Tmem184a T A 5: 139,807,640 K235N probably benign Het
Tnpo1 A T 13: 98,856,907 D590E probably damaging Het
Trio C A 15: 27,740,967 G2724V probably damaging Het
Ttc6 A T 12: 57,649,515 Y34F possibly damaging Het
Tuba4a T C 1: 75,216,401 T190A probably benign Het
Tubgcp4 T G 2: 121,176,550 V136G possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r74 T C 7: 11,847,583 I270T probably benign Het
Vmn2r60 T A 7: 42,136,713 F313L probably benign Het
Zfp710 T C 7: 80,082,004 Y310H probably damaging Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 19793102 missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 19794965 missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 19792997 missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 19792967 missense probably benign
IGL01404:Vmn2r103 APN 17 19812434 missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 19794068 missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 19799208 missense probably benign
IGL02251:Vmn2r103 APN 17 19793969 missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19773369 missense probably benign
IGL02555:Vmn2r103 APN 17 19811611 missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 19794127 missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 19793956 missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 19812248 missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19773520 missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 19811979 missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 19811641 missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 19792859 missense probably benign 0.06
R0375:Vmn2r103 UTSW 17 19793464 missense probably benign 0.12
R0755:Vmn2r103 UTSW 17 19773568 missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 19793927 missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 19794247 missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 19792968 missense probably benign
R1533:Vmn2r103 UTSW 17 19773400 missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 19794234 missense probably benign
R1928:Vmn2r103 UTSW 17 19811767 missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 19812300 missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 19793794 missense probably benign
R2219:Vmn2r103 UTSW 17 19793647 missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19773531 missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 19793600 missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 19812149 missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 19794233 missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 19811815 missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 19811769 missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 19812171 missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 19793642 missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 19792989 missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 19794939 missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 19812453 missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 19794216 nonsense probably null
R6114:Vmn2r103 UTSW 17 19812325 missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 19812144 missense probably benign
R6292:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 19794082 missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 19811904 missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 19811977 missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 19793477 missense probably benign 0.00
Z1088:Vmn2r103 UTSW 17 19795047 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTCTCTCTACCAGATGGCCCCTAAGG -3'
(R):5'- GCAAATCACTTATGCCAGAGTGCTGAC -3'

Sequencing Primer
(F):5'- AAGGACACATCTCTTTCACTTGC -3'
(R):5'- TGTCAGCAAATGAGCACTTG -3'
Posted On2014-03-28