Incidental Mutation 'R1493:Stk25'
ID165527
Institutional Source Beutler Lab
Gene Symbol Stk25
Ensembl Gene ENSMUSG00000026277
Gene Nameserine/threonine kinase 25 (yeast)
Synonyms1500019J11Rik, SOK-1, Ste20-like, Ysk1
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1493 (G1)
Quality Score224
Status Not validated
Chromosome1
Chromosomal Location93619751-93658659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93625600 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 260 (T260A)
Ref Sequence ENSEMBL: ENSMUSP00000027498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027498] [ENSMUST00000120301] [ENSMUST00000133769] [ENSMUST00000186287]
Predicted Effect probably benign
Transcript: ENSMUST00000027498
AA Change: T260A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027498
Gene: ENSMUSG00000026277
AA Change: T260A

DomainStartEndE-ValueType
S_TKc 20 270 2.92e-98 SMART
low complexity region 292 314 N/A INTRINSIC
PDB:3W8H|B 355 426 8e-43 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000120301
SMART Domains Protein: ENSMUSP00000112725
Gene: ENSMUSG00000034066

DomainStartEndE-ValueType
B41 40 234 1.48e-66 SMART
FERM_C 238 328 3.29e-35 SMART
FA 332 378 1.13e-15 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
RhoGEF 542 728 1.57e-56 SMART
PH 759 857 1.45e-19 SMART
low complexity region 879 890 N/A INTRINSIC
PH 931 1029 2.62e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125778
Predicted Effect probably benign
Transcript: ENSMUST00000133769
SMART Domains Protein: ENSMUSP00000117765
Gene: ENSMUSG00000026277

DomainStartEndE-ValueType
Pfam:Pkinase 20 233 1.7e-63 PFAM
Pfam:Pkinase_Tyr 20 233 2.1e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154008
Predicted Effect probably benign
Transcript: ENSMUST00000186287
SMART Domains Protein: ENSMUSP00000140396
Gene: ENSMUSG00000026277

DomainStartEndE-ValueType
STYKc 20 107 1.9e-4 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the germinal centre kinase III (GCK III) subfamily of the sterile 20 superfamily of kinases. The encoded enzyme plays a role in serine-threonine liver kinase B1 (LKB1) signaling pathway to regulate neuronal polarization and morphology of the Golgi apparatus. The protein is translocated from the Golgi apparatus to the nucleus in response to chemical anoxia and plays a role in regulation of cell death. A pseudogene associated with this gene is located on chromosome 18. Multiple alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Germ line null mutants display normal cortical layers and neuronal migration. Acute loss of expression results in impaired neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Stk25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Stk25 APN 1 93623423 unclassified probably null
IGL02952:Stk25 APN 1 93626076 missense probably damaging 1.00
IGL03144:Stk25 APN 1 93629136 missense probably damaging 1.00
ANU05:Stk25 UTSW 1 93623423 unclassified probably null
IGL02980:Stk25 UTSW 1 93627668 missense probably damaging 1.00
PIT4531001:Stk25 UTSW 1 93624624 missense probably benign
R0240:Stk25 UTSW 1 93627060 missense probably damaging 1.00
R0240:Stk25 UTSW 1 93627060 missense probably damaging 1.00
R0555:Stk25 UTSW 1 93624591 missense probably benign 0.00
R1178:Stk25 UTSW 1 93623389 unclassified probably benign
R1406:Stk25 UTSW 1 93625153 unclassified probably benign
R2875:Stk25 UTSW 1 93629251 missense possibly damaging 0.91
R4657:Stk25 UTSW 1 93625656 unclassified probably benign
R4668:Stk25 UTSW 1 93625483 missense probably damaging 1.00
R4686:Stk25 UTSW 1 93623420 unclassified probably null
R5089:Stk25 UTSW 1 93624608 missense probably benign 0.05
R5493:Stk25 UTSW 1 93635309 missense probably benign
R6013:Stk25 UTSW 1 93625459 critical splice donor site probably null
X0063:Stk25 UTSW 1 93625961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGTAACCAAGCCCTGCCTCTG -3'
(R):5'- CTGCCTCAATAAGGACCCACGATTC -3'

Sequencing Primer
(F):5'- TCTGGAGAGAAGACCTCCACTG -3'
(R):5'- TAAGGACCCACGATTCGTAAG -3'
Posted On2014-03-28