Mutagenetix > Incidental Mutation

Incidental Mutation 'R1493:Axdnd1'

165529

Institutional Source

Beutler Lab

Gene Symbol

Axdnd1

Ensembl Gene

ENSMUSG00000026601

Gene Name

axonemal dynein light chain domain containing 1

Synonyms

LOC381304, 9430070O13Rik

MMRRC Submission

039544-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R1493 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

156323509-156421159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 156346701 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 799 (M799L)

Ref Sequence

ENSEMBL: ENSMUSP00000148420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000213088]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000177824
AA Change: M734L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601
AA Change: M734L

Domain	Start	End	E-Value	Type
Pfam:Ax_dynein_light	131	314	2.4e-12	PFAM
low complexity region	405	414	N/A	INTRINSIC
low complexity region	452	464	N/A	INTRINSIC
low complexity region	666	677	N/A	INTRINSIC
coiled coil region	787	837	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178036
AA Change: M799L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: M799L

Domain	Start	End	E-Value	Type
Pfam:Ax_dynein_light	196	380	3.3e-14	PFAM
low complexity region	470	479	N/A	INTRINSIC
low complexity region	517	529	N/A	INTRINSIC
low complexity region	731	742	N/A	INTRINSIC
coiled coil region	889	939	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000213088
AA Change: M799L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.2%
20x: 92.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	T	C	11: 58,876,718	S14P	probably damaging	Het
Abca15	A	T	7: 120,382,290	D989V	probably benign	Het
Abcg8	T	C	17: 84,696,679	S472P	probably damaging	Het
Ablim2	T	C	5: 35,809,261	F178S	probably damaging	Het
Adprm	A	G	11: 67,041,876	V69A	possibly damaging	Het
Ankrd27	C	T	7: 35,608,365	S343L	probably benign	Het
Arfgef3	A	G	10: 18,630,879	S833P	probably damaging	Het
Arhgap42	T	G	9: 9,030,797	E339D	probably benign	Het
Cars2	A	T	8: 11,517,817		probably null	Het
Cd7	T	C	11: 121,038,141	T95A	probably damaging	Het
Cep290	A	T	10: 100,562,181	T2200S	probably benign	Het
Cep44	A	G	8: 56,532,835	S299P	probably damaging	Het
Cfap58	C	T	19: 47,988,504	H731Y	probably damaging	Het
Ehbp1	T	A	11: 22,006,866	E1204V	probably damaging	Het
Fam129a	T	A	1: 151,706,090	V479D	probably damaging	Het
Fam208a	A	G	14: 27,449,969	S425G	probably damaging	Het
Fgd5	A	G	6: 91,987,631	K124E	probably benign	Het
Folh1	T	C	7: 86,761,730	D268G	probably damaging	Het
Gm4559	A	T	7: 142,274,313	C17*	probably null	Het
Gm9833	A	G	3: 10,088,884	K238E	probably damaging	Het
Helz	A	G	11: 107,613,925	I413V	probably benign	Het
Hexdc	A	G	11: 121,221,267	I438V	probably benign	Het
Hrh1	G	A	6: 114,480,877	G373D	probably damaging	Het
Hs3st5	G	A	10: 36,832,874	G135D	probably damaging	Het
Iqcf6	T	C	9: 106,627,442	Y102H	probably benign	Het
Kmt2a	A	T	9: 44,846,905	S1124R	probably damaging	Het
Map3k5	A	G	10: 20,029,113	D387G	probably damaging	Het
Morc2a	A	G	11: 3,678,557	N337D	probably benign	Het
Musk	C	T	4: 58,354,003	A352V	probably benign	Het
Nans	G	A	4: 46,500,761	E218K	probably damaging	Het
Ninl	T	G	2: 150,980,095	D29A	probably damaging	Het
Nod1	A	G	6: 54,944,056	F426L	probably damaging	Het
Notch4	T	A	17: 34,567,682	C265*	probably null	Het
Nsd3	A	G	8: 25,713,380	D1307G	probably benign	Het
Olfr555	T	C	7: 102,659,013	L64P	probably damaging	Het
Olfr670	T	A	7: 104,960,502	T77S	probably damaging	Het
Orai3	G	A	7: 127,773,905	V193M	possibly damaging	Het
Prkag1	T	C	15: 98,813,670	Y271C	probably benign	Het
Rfc4	T	C	16: 23,118,008	I116V	probably damaging	Het
Ric1	T	C	19: 29,579,849	Y445H	probably benign	Het
Rnmt	G	A	18: 68,313,707	D268N	probably damaging	Het
Rsph1	C	T	17: 31,265,899	G139D	probably damaging	Het
Sez6l2	C	A	7: 126,961,812	P483Q	probably damaging	Het
Sgo2b	A	G	8: 63,926,855	L981P	probably damaging	Het
Shmt2	A	G	10: 127,518,943		probably null	Het
Sorbs3	T	C	14: 70,192,627	T353A	possibly damaging	Het
Stk25	T	C	1: 93,625,600	T260A	probably benign	Het
Thap12	A	G	7: 98,715,438	H271R	probably benign	Het
Tmprss13	A	G	9: 45,336,107	T256A	probably benign	Het
Tpo	A	T	12: 30,131,809	I29N	possibly damaging	Het
Trpc2	A	T	7: 102,090,576	N569I	probably damaging	Het
Unc13c	T	C	9: 73,639,068	T1607A	probably benign	Het
Vldlr	A	G	19: 27,241,291	N514S	probably benign	Het
Vps18	A	G	2: 119,297,132	Y812C	probably damaging	Het
Zfp692	A	T	11: 58,314,040	I409F	probably damaging	Het
Zfp735	G	A	11: 73,710,479	C83Y	possibly damaging	Het
Zic1	A	G	9: 91,364,756	S88P	probably damaging	Het

Other mutations in Axdnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03058:Axdnd1	APN	1	156376663	missense	probably benign	0.41
IGL03075:Axdnd1	APN	1	156395442	missense	probably damaging	1.00
IGL03165:Axdnd1	APN	1	156378389	missense	probably benign	0.00
R0164:Axdnd1	UTSW	1	156378386	missense	possibly damaging	0.93
R0164:Axdnd1	UTSW	1	156378386	missense	possibly damaging	0.93
R0739:Axdnd1	UTSW	1	156380886	missense	possibly damaging	0.73
R1087:Axdnd1	UTSW	1	156365689	missense	probably benign	0.08
R1350:Axdnd1	UTSW	1	156378380	critical splice donor site	probably null
R1488:Axdnd1	UTSW	1	156348960	missense	probably damaging	1.00
R1845:Axdnd1	UTSW	1	156376544	missense	possibly damaging	0.58
R1900:Axdnd1	UTSW	1	156380774	splice site	probably null
R2126:Axdnd1	UTSW	1	156333214	missense	probably benign	0.03
R2163:Axdnd1	UTSW	1	156392003	missense	probably damaging	1.00
R2169:Axdnd1	UTSW	1	156418309	missense	probably damaging	1.00
R2380:Axdnd1	UTSW	1	156365651	missense	probably benign	0.02
R2568:Axdnd1	UTSW	1	156392749	missense	possibly damaging	0.90
R3052:Axdnd1	UTSW	1	156341870	missense	probably damaging	0.96
R3053:Axdnd1	UTSW	1	156341870	missense	probably damaging	0.96
R3767:Axdnd1	UTSW	1	156380858	missense	probably damaging	1.00
R3927:Axdnd1	UTSW	1	156419270	missense	probably damaging	1.00
R3936:Axdnd1	UTSW	1	156331639	missense	probably benign	0.01
R4829:Axdnd1	UTSW	1	156376646	missense	possibly damaging	0.93
R4882:Axdnd1	UTSW	1	156395559	splice site	probably null
R4969:Axdnd1	UTSW	1	156395505	missense	possibly damaging	0.95
R5091:Axdnd1	UTSW	1	156420410	missense	possibly damaging	0.83
R5510:Axdnd1	UTSW	1	156335350	missense	probably benign	0.03
R5549:Axdnd1	UTSW	1	156398534	missense	probably damaging	1.00
R5587:Axdnd1	UTSW	1	156351412	missense	probably damaging	1.00
R5792:Axdnd1	UTSW	1	156341889	missense	probably damaging	0.99
R5840:Axdnd1	UTSW	1	156348958	missense	probably damaging	1.00
R6187:Axdnd1	UTSW	1	156365612	splice site	probably null
R6208:Axdnd1	UTSW	1	156392856	intron	probably benign
R6369:Axdnd1	UTSW	1	156392745	missense	probably damaging	1.00
R6493:Axdnd1	UTSW	1	156380813	missense	probably damaging	1.00
R7014:Axdnd1	UTSW	1	156330962	splice site	probably null
R7115:Axdnd1	UTSW	1	156380876	missense
R7203:Axdnd1	UTSW	1	156382389	missense	probably damaging	0.98
R7352:Axdnd1	UTSW	1	156382477	missense	possibly damaging	0.91
R7447:Axdnd1	UTSW	1	156418232	critical splice donor site	probably null
R7470:Axdnd1	UTSW	1	156376516	missense
R7686:Axdnd1	UTSW	1	156395464	nonsense	probably null
R7793:Axdnd1	UTSW	1	156338743	critical splice donor site	probably null
R7809:Axdnd1	UTSW	1	156392801	nonsense	probably null
R7882:Axdnd1	UTSW	1	156397453	missense
R8256:Axdnd1	UTSW	1	156330666	missense	unknown
R8348:Axdnd1	UTSW	1	156418284	missense	probably benign	0.02
R8971:Axdnd1	UTSW	1	156391946	missense
R9207:Axdnd1	UTSW	1	156388046	missense
R9294:Axdnd1	UTSW	1	156420347	nonsense	probably null
R9741:Axdnd1	UTSW	1	156341815	missense	probably benign	0.18
X0009:Axdnd1	UTSW	1	156388079	missense	possibly damaging	0.61
X0067:Axdnd1	UTSW	1	156376535	missense	possibly damaging	0.67
Z1176:Axdnd1	UTSW	1	156349063	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ctcctCTCAAAGCACACTGATGACAA -3'
(R):5'- CCACTATCTCATCTGTCtctgtctgtct -3'

Sequencing Primer
(F):5'- ccgttctcttccactacctc -3'
(R):5'- ctgtctgtctgactctgtctg -3'

Posted On

2014-03-28