Incidental Mutation 'R1493:Musk'
ID165537
Institutional Source Beutler Lab
Gene Symbol Musk
Ensembl Gene ENSMUSG00000057280
Gene Namemuscle, skeletal, receptor tyrosine kinase
SynonymsMDK4, Nsk1, Nsk2, Nsk3
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1493 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location58285960-58374303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58354003 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 352 (A352V)
Ref Sequence ENSEMBL: ENSMUSP00000095665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081919] [ENSMUST00000084578] [ENSMUST00000098057] [ENSMUST00000098059] [ENSMUST00000102893] [ENSMUST00000177951] [ENSMUST00000179951]
Predicted Effect probably benign
Transcript: ENSMUST00000081919
AA Change: A327V

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000080590
Gene: ENSMUSG00000057280
AA Change: A327V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.1e-27 PFAM
transmembrane domain 495 517 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
TyrKc 574 855 2.96e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084578
AA Change: A327V

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000081625
Gene: ENSMUSG00000057280
AA Change: A327V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.2e-28 PFAM
transmembrane domain 495 517 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
TyrKc 574 855 2.96e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098057
AA Change: A352V

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095665
Gene: ENSMUSG00000057280
AA Change: A352V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
Pfam:Fz 342 467 1.4e-15 PFAM
transmembrane domain 520 542 N/A INTRINSIC
low complexity region 543 554 N/A INTRINSIC
low complexity region 583 592 N/A INTRINSIC
TyrKc 599 880 2.96e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098059
AA Change: A337V

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095667
Gene: ENSMUSG00000057280
AA Change: A337V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
low complexity region 303 318 N/A INTRINSIC
Pfam:Fz 327 458 2.1e-28 PFAM
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 520 531 N/A INTRINSIC
low complexity region 560 569 N/A INTRINSIC
TyrKc 576 857 2.96e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102893
AA Change: A327V

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099957
Gene: ENSMUSG00000057280
AA Change: A327V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.1e-27 PFAM
transmembrane domain 487 509 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
TyrKc 566 847 2.96e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177951
AA Change: A337V

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136696
Gene: ENSMUSG00000057280
AA Change: A337V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
Pfam:Fz 327 458 1.1e-27 PFAM
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 520 531 N/A INTRINSIC
low complexity region 560 569 N/A INTRINSIC
TyrKc 576 857 2.96e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179951
AA Change: A337V

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137453
Gene: ENSMUSG00000057280
AA Change: A337V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
low complexity region 303 318 N/A INTRINSIC
Pfam:Fz 327 458 1.2e-27 PFAM
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
TyrKc 584 865 2.96e-140 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is a type 1 receptor-like protein located in muscle membrane that is activated by the heparan sulfate proteoglycan agrin released by nerve cells. The encoded protein activates signaling cascades responsible for multiple aspects of motor neuron and muscle development, including organization of the postsynaptic membrane, synaptic gene transcription, patterning of skeletal muscle, anchoring of acetylcholinesterase, and guidance of motor axons. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation lack neuromuscular synapses and spontaneous movement, and die at birth of respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Musk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Musk APN 4 58367539 missense probably damaging 1.00
IGL01727:Musk APN 4 58303887 missense probably benign 0.37
IGL01981:Musk APN 4 58296629 missense probably damaging 1.00
IGL02064:Musk APN 4 58286128 missense possibly damaging 0.89
IGL02326:Musk APN 4 58354113 missense probably benign 0.02
IGL02475:Musk APN 4 58353936 critical splice acceptor site probably benign
IGL02585:Musk APN 4 58347849 missense probably benign
IGL02719:Musk APN 4 58356496 missense probably benign
IGL02797:Musk APN 4 58366921 missense probably benign 0.00
IGL02869:Musk APN 4 58354078 missense probably benign 0.05
IGL02940:Musk APN 4 58373364 missense probably damaging 1.00
IGL03167:Musk APN 4 58366821 missense possibly damaging 0.81
IGL03230:Musk APN 4 58296710 missense probably damaging 1.00
R0384:Musk UTSW 4 58373711 makesense probably null
R1014:Musk UTSW 4 58354156 missense possibly damaging 0.88
R1462:Musk UTSW 4 58286204 splice site probably benign
R1739:Musk UTSW 4 58293563 missense probably damaging 1.00
R1883:Musk UTSW 4 58373189 missense probably benign 0.18
R2230:Musk UTSW 4 58333672 missense possibly damaging 0.79
R2914:Musk UTSW 4 58366938 missense probably damaging 0.99
R3508:Musk UTSW 4 58327347 missense probably damaging 0.98
R4225:Musk UTSW 4 58373240 missense probably damaging 0.99
R4601:Musk UTSW 4 58301625 missense probably damaging 0.99
R4771:Musk UTSW 4 58301706 missense probably benign 0.16
R4793:Musk UTSW 4 58373400 missense probably damaging 1.00
R4845:Musk UTSW 4 58296679 missense probably damaging 1.00
R4919:Musk UTSW 4 58366899 missense probably damaging 1.00
R4954:Musk UTSW 4 58344222 missense probably damaging 0.96
R5596:Musk UTSW 4 58373036 missense probably damaging 1.00
R5715:Musk UTSW 4 58333663 missense probably damaging 1.00
R5894:Musk UTSW 4 58373583 missense probably damaging 1.00
R5934:Musk UTSW 4 58373613 missense probably damaging 1.00
R6230:Musk UTSW 4 58367576 missense probably damaging 1.00
R6335:Musk UTSW 4 58366811 missense probably benign
R6358:Musk UTSW 4 58373171 missense possibly damaging 0.72
R6395:Musk UTSW 4 58286169 missense probably benign
R6652:Musk UTSW 4 58368977 missense probably damaging 1.00
R6764:Musk UTSW 4 58354027 missense probably damaging 1.00
R7233:Musk UTSW 4 58373307 missense possibly damaging 0.83
R7238:Musk UTSW 4 58344312 missense probably benign 0.01
R7271:Musk UTSW 4 58373409 missense probably damaging 1.00
R7511:Musk UTSW 4 58333672 missense probably benign 0.10
X0020:Musk UTSW 4 58368996 missense probably damaging 1.00
X0066:Musk UTSW 4 58327356 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCCAAATTCACTCAGCTCTTGACC -3'
(R):5'- TGACAATGTCCTCTCTGGCAAACTC -3'

Sequencing Primer
(F):5'- ACGATCTTTGTCACAGCCTGAG -3'
(R):5'- CTGGCAAACTCTTGGCATATGG -3'
Posted On2014-03-28