Incidental Mutation 'R1493:Fgd5'
ID165541
Institutional Source Beutler Lab
Gene Symbol Fgd5
Ensembl Gene ENSMUSG00000034037
Gene NameFYVE, RhoGEF and PH domain containing 5
SynonymsC330025N11Rik, ZFYVE23
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R1493 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location91978878-92076004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91987631 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 124 (K124E)
Ref Sequence ENSEMBL: ENSMUSP00000109093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089334] [ENSMUST00000113466]
Predicted Effect probably benign
Transcript: ENSMUST00000089334
AA Change: K282E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086748
Gene: ENSMUSG00000034037
AA Change: K282E

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
internal_repeat_1 126 169 2.6e-7 PROSPERO
internal_repeat_1 164 198 2.6e-7 PROSPERO
low complexity region 201 222 N/A INTRINSIC
low complexity region 254 269 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 426 442 N/A INTRINSIC
low complexity region 453 475 N/A INTRINSIC
low complexity region 652 663 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
low complexity region 727 736 N/A INTRINSIC
low complexity region 879 894 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Pfam:RhoGEF 946 1134 2.2e-28 PFAM
PH 1165 1260 4.93e-13 SMART
FYVE 1285 1353 2.51e-16 SMART
low complexity region 1368 1390 N/A INTRINSIC
PH 1416 1514 2.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113466
AA Change: K124E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109093
Gene: ENSMUSG00000034037
AA Change: K124E

DomainStartEndE-ValueType
low complexity region 43 64 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 268 284 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 537 547 N/A INTRINSIC
low complexity region 569 578 N/A INTRINSIC
low complexity region 721 736 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
Pfam:RhoGEF 788 976 1.6e-27 PFAM
PH 1007 1102 4.93e-13 SMART
FYVE 1127 1195 2.51e-16 SMART
low complexity region 1210 1232 N/A INTRINSIC
PH 1258 1356 2.77e-7 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Fgd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Fgd5 APN 6 91988459 missense possibly damaging 0.63
IGL01354:Fgd5 APN 6 92061843 nonsense probably null
IGL01597:Fgd5 APN 6 91987929 missense probably damaging 1.00
IGL01648:Fgd5 APN 6 91989359 nonsense probably null
IGL01781:Fgd5 APN 6 91988717 missense possibly damaging 0.88
IGL01977:Fgd5 APN 6 92024562 missense probably benign 0.20
IGL02053:Fgd5 APN 6 92053244 missense probably benign 0.03
IGL02206:Fgd5 APN 6 91987258 utr 5 prime probably benign
IGL02825:Fgd5 APN 6 92038087 splice site probably null
IGL02838:Fgd5 APN 6 91987674 missense probably benign
IGL03126:Fgd5 APN 6 92065164 missense probably damaging 1.00
IGL03369:Fgd5 APN 6 91988415 missense probably damaging 1.00
hygeia UTSW 6 91989300 missense probably damaging 1.00
R0029:Fgd5 UTSW 6 92067558 missense probably benign 0.04
R0109:Fgd5 UTSW 6 91988235 missense possibly damaging 0.74
R0109:Fgd5 UTSW 6 91988235 missense possibly damaging 0.74
R0212:Fgd5 UTSW 6 91988208 missense probably damaging 1.00
R1148:Fgd5 UTSW 6 91987631 missense probably benign
R1148:Fgd5 UTSW 6 91987631 missense probably benign
R1159:Fgd5 UTSW 6 91988502 missense probably benign 0.00
R1199:Fgd5 UTSW 6 91986978 missense possibly damaging 0.87
R1602:Fgd5 UTSW 6 92066184 missense possibly damaging 0.95
R1953:Fgd5 UTSW 6 92024630 missense probably benign 0.31
R2280:Fgd5 UTSW 6 91988945 missense possibly damaging 0.86
R2437:Fgd5 UTSW 6 92062869 nonsense probably null
R2883:Fgd5 UTSW 6 91987109 unclassified probably null
R4133:Fgd5 UTSW 6 92069437 missense probably damaging 1.00
R4454:Fgd5 UTSW 6 91989186 missense probably damaging 1.00
R4491:Fgd5 UTSW 6 91989299 missense possibly damaging 0.90
R4606:Fgd5 UTSW 6 91988209 missense possibly damaging 0.67
R4981:Fgd5 UTSW 6 91989300 missense probably damaging 1.00
R5162:Fgd5 UTSW 6 92074234 missense probably damaging 1.00
R5525:Fgd5 UTSW 6 92066247 missense probably damaging 1.00
R5570:Fgd5 UTSW 6 91988687 missense probably damaging 1.00
R5936:Fgd5 UTSW 6 91987911 missense probably damaging 0.98
R6012:Fgd5 UTSW 6 91989341 missense possibly damaging 0.95
R6723:Fgd5 UTSW 6 91988030 missense probably benign
R6764:Fgd5 UTSW 6 91989421 missense probably damaging 0.96
R7187:Fgd5 UTSW 6 91988291 missense possibly damaging 0.54
R7383:Fgd5 UTSW 6 91987118 missense probably benign 0.01
R7418:Fgd5 UTSW 6 92024538 missense probably benign 0.11
R7788:Fgd5 UTSW 6 91988459 missense possibly damaging 0.63
R7882:Fgd5 UTSW 6 92068478 missense probably damaging 1.00
R7895:Fgd5 UTSW 6 91987281 missense probably benign 0.03
R7965:Fgd5 UTSW 6 92068478 missense probably damaging 1.00
R7978:Fgd5 UTSW 6 91987281 missense probably benign 0.03
R8041:Fgd5 UTSW 6 92061856 missense probably damaging 0.98
R8053:Fgd5 UTSW 6 91989444 missense probably benign 0.34
X0064:Fgd5 UTSW 6 92050040 missense probably benign 0.02
Z1176:Fgd5 UTSW 6 91988889 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTGTACAACAGTGATAACAGGGC -3'
(R):5'- CTCTCAAAGGGAATGATCTGGCAGC -3'

Sequencing Primer
(F):5'- TGATAACAGGGCACCCTGG -3'
(R):5'- GAATGATCTGGCAGCTTTCC -3'
Posted On2014-03-28