Incidental Mutation 'R1493:Hrh1'
ID165542
Institutional Source Beutler Lab
Gene Symbol Hrh1
Ensembl Gene ENSMUSG00000053004
Gene Namehistamine receptor H1
SynonymsHir, Bphs
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1493 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location114397936-114483296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 114480877 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 373 (G373D)
Ref Sequence ENSEMBL: ENSMUSP00000124460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088987] [ENSMUST00000160212] [ENSMUST00000160780] [ENSMUST00000161220] [ENSMUST00000161650]
Predicted Effect probably damaging
Transcript: ENSMUST00000088987
AA Change: G373D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086383
Gene: ENSMUSG00000053004
AA Change: G373D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 1.1e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160212
Predicted Effect probably damaging
Transcript: ENSMUST00000160780
AA Change: G373D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124320
Gene: ENSMUSG00000053004
AA Change: G373D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 3.3e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161220
AA Change: G373D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124037
Gene: ENSMUSG00000053004
AA Change: G373D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 1.1e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161650
AA Change: G373D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124460
Gene: ENSMUSG00000053004
AA Change: G373D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 1.1e-72 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. The protein encoded by this gene is an integral membrane protein and belongs to the G protein-coupled receptor superfamily. It mediates the contraction of smooth muscles, the increase in capillary permeability due to contraction of terminal venules, the release of catecholamine from adrenal medulla, and neurotransmission in the central nervous system. It has been associated with multiple processes, including memory and learning, circadian rhythm, and thermoregulation. It is also known to contribute to the pathophysiology of allergic diseases such as atopic dermatitis, asthma, anaphylaxis and allergic rhinitis. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous null mutants show decrease in exploratory behavior, diurnal activity, aggression, anxiety, serotonin release, respiratory reaction to temperature and leptin response. Natural variants affect B. pertussis induced vasoactive amine sensitization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Hrh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Hrh1 APN 6 114480322 missense probably damaging 0.99
IGL01372:Hrh1 APN 6 114479997 missense probably damaging 1.00
IGL01453:Hrh1 APN 6 114481162 missense probably damaging 1.00
IGL01519:Hrh1 APN 6 114480301 missense probably damaging 1.00
IGL02142:Hrh1 APN 6 114480243 missense probably damaging 1.00
IGL02352:Hrh1 APN 6 114480443 missense probably benign 0.43
IGL02359:Hrh1 APN 6 114480443 missense probably benign 0.43
FR4737:Hrh1 UTSW 6 114481123 missense possibly damaging 0.95
R0335:Hrh1 UTSW 6 114480232 missense probably damaging 1.00
R0635:Hrh1 UTSW 6 114480145 missense probably damaging 1.00
R2283:Hrh1 UTSW 6 114480439 missense probably benign 0.00
R3870:Hrh1 UTSW 6 114480919 missense probably damaging 1.00
R4124:Hrh1 UTSW 6 114480619 missense probably benign 0.06
R4254:Hrh1 UTSW 6 114480001 missense probably damaging 1.00
R4764:Hrh1 UTSW 6 114480535 missense probably benign 0.00
R5270:Hrh1 UTSW 6 114481218 missense possibly damaging 0.75
R6189:Hrh1 UTSW 6 114479998 missense probably damaging 1.00
R6482:Hrh1 UTSW 6 114480763 missense possibly damaging 0.93
R7495:Hrh1 UTSW 6 114480673 missense probably benign 0.05
R7683:Hrh1 UTSW 6 114479787 missense probably benign
R8041:Hrh1 UTSW 6 114479917 missense not run
Predicted Primers PCR Primer
(F):5'- AAGGTGACCTCTCCGACTGTCTTC -3'
(R):5'- TGCTGCCATGATACAACCCAACTG -3'

Sequencing Primer
(F):5'- CGACTGTCTTCAGCCAAGAG -3'
(R):5'- GATACAACCCAACTGCTTGGC -3'
Posted On2014-03-28