Incidental Mutation 'R1493:Olfr555'
ID165547
Institutional Source Beutler Lab
Gene Symbol Olfr555
Ensembl Gene ENSMUSG00000073970
Gene Nameolfactory receptor 555
SynonymsMOR10-1, GA_x6K02T2PBJ9-5375442-5376389
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R1493 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102658823-102659770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102659013 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 64 (L64P)
Ref Sequence ENSEMBL: ENSMUSP00000095823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098220]
Predicted Effect probably damaging
Transcript: ENSMUST00000098220
AA Change: L64P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095823
Gene: ENSMUSG00000073970
AA Change: L64P

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.5e-126 PFAM
Pfam:7TM_GPCR_Srsx 36 308 1.7e-7 PFAM
Pfam:7tm_1 42 293 1.2e-19 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Olfr555
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr555 APN 7 102659348 missense probably damaging 0.98
IGL01150:Olfr555 APN 7 102659492 missense probably benign 0.00
IGL02610:Olfr555 APN 7 102659567 missense probably benign 0.41
IGL02679:Olfr555 APN 7 102659177 missense possibly damaging 0.55
R0332:Olfr555 UTSW 7 102659465 missense probably damaging 0.99
R1631:Olfr555 UTSW 7 102659201 missense probably damaging 1.00
R1682:Olfr555 UTSW 7 102659697 missense probably damaging 0.96
R3026:Olfr555 UTSW 7 102659129 missense possibly damaging 0.90
R3103:Olfr555 UTSW 7 102659481 missense probably benign 0.00
R4592:Olfr555 UTSW 7 102659478 missense probably damaging 0.99
R4782:Olfr555 UTSW 7 102658834 missense possibly damaging 0.63
R6282:Olfr555 UTSW 7 102659647 missense probably benign 0.00
R7571:Olfr555 UTSW 7 102659051 missense probably damaging 1.00
R8001:Olfr555 UTSW 7 102659034 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCATTCTGACAGGCATCCCAG -3'
(R):5'- GGCACAGGCTAACCTCATTGCATC -3'

Sequencing Primer
(F):5'- ATCCCAGGGATGCCAGAC -3'
(R):5'- GCATAACGCAATGGGTCTC -3'
Posted On2014-03-28