Incidental Mutation 'R1493:Sez6l2'
ID165550
Institutional Source Beutler Lab
Gene Symbol Sez6l2
Ensembl Gene ENSMUSG00000030683
Gene Nameseizure related 6 homolog like 2
SynonymsPsk1
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1493 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126950563-126970606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 126961812 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 483 (P483Q)
Ref Sequence ENSEMBL: ENSMUSP00000101942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106332] [ENSMUST00000106333] [ENSMUST00000106335] [ENSMUST00000146017]
Predicted Effect probably damaging
Transcript: ENSMUST00000106332
AA Change: P423Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101939
Gene: ENSMUSG00000030683
AA Change: P423Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 70 86 N/A INTRINSIC
low complexity region 93 108 N/A INTRINSIC
CUB 113 226 8.25e-4 SMART
CCP 230 285 3.75e-15 SMART
CUB 289 399 1.3e-3 SMART
CCP 404 463 8.9e-8 SMART
CUB 467 578 3.45e-14 SMART
CCP 584 639 1.18e-12 SMART
CCP 645 704 1.31e-14 SMART
CCP 711 768 2.76e-13 SMART
transmembrane domain 798 820 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106333
AA Change: P483Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101940
Gene: ENSMUSG00000030683
AA Change: P483Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 115 146 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
CUB 173 286 8.25e-4 SMART
CCP 290 345 3.75e-15 SMART
CUB 349 459 1.3e-3 SMART
CCP 464 523 8.9e-8 SMART
CUB 527 638 3.45e-14 SMART
CCP 644 699 1.18e-12 SMART
CCP 705 764 1.31e-14 SMART
CCP 771 828 2.76e-13 SMART
transmembrane domain 858 880 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106335
AA Change: P483Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101942
Gene: ENSMUSG00000030683
AA Change: P483Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 115 146 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
CUB 173 286 8.25e-4 SMART
CCP 290 345 3.75e-15 SMART
CUB 349 459 1.3e-3 SMART
CCP 464 523 8.9e-8 SMART
CUB 527 638 3.45e-14 SMART
CCP 644 699 1.18e-12 SMART
CCP 705 764 1.31e-14 SMART
CCP 771 828 2.76e-13 SMART
transmembrane domain 845 867 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125669
Predicted Effect probably benign
Transcript: ENSMUST00000146017
SMART Domains Protein: ENSMUSP00000115905
Gene: ENSMUSG00000030683

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 72 91 N/A INTRINSIC
Meta Mutation Damage Score 0.1440 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seizure-related protein that is localized on the cell surface. The gene is located in a region of chromosome 16p11.2 that is thought to contain candidate genes for autism spectrum disorders (ASD), though there is no evidence directly implicating this gene in ASD. Increased expression of this gene has been found in lung cancers, and the protein is therefore considered to be a novel prognostic marker for lung cancer. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no apparent defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Sez6l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Sez6l2 APN 7 126961883 missense possibly damaging 0.91
IGL01710:Sez6l2 APN 7 126968216 missense probably damaging 1.00
IGL02439:Sez6l2 APN 7 126968189 missense probably damaging 0.99
IGL02752:Sez6l2 APN 7 126953733 missense probably damaging 1.00
H8786:Sez6l2 UTSW 7 126961783 missense possibly damaging 0.95
R0783:Sez6l2 UTSW 7 126967145 missense possibly damaging 0.65
R0989:Sez6l2 UTSW 7 126959844 missense probably damaging 1.00
R1148:Sez6l2 UTSW 7 126961812 missense probably damaging 1.00
R1148:Sez6l2 UTSW 7 126961812 missense probably damaging 1.00
R1509:Sez6l2 UTSW 7 126963363 missense probably damaging 1.00
R1704:Sez6l2 UTSW 7 126958341 missense probably damaging 1.00
R1817:Sez6l2 UTSW 7 126967119 missense probably damaging 1.00
R1889:Sez6l2 UTSW 7 126953496 missense probably damaging 1.00
R2509:Sez6l2 UTSW 7 126953772 missense probably benign 0.31
R3772:Sez6l2 UTSW 7 126959203 missense probably damaging 0.99
R4466:Sez6l2 UTSW 7 126959851 missense probably damaging 0.97
R4869:Sez6l2 UTSW 7 126961842 missense probably benign 0.02
R5155:Sez6l2 UTSW 7 126962373 missense probably damaging 0.99
R5416:Sez6l2 UTSW 7 126961886 missense probably damaging 1.00
R5551:Sez6l2 UTSW 7 126966830 missense probably damaging 1.00
R5884:Sez6l2 UTSW 7 126970156 unclassified probably benign
R5903:Sez6l2 UTSW 7 126970133 unclassified probably benign
R6015:Sez6l2 UTSW 7 126953453 missense probably damaging 0.97
R6726:Sez6l2 UTSW 7 126968005 missense probably damaging 0.96
R7094:Sez6l2 UTSW 7 126952924 missense probably damaging 0.99
R7117:Sez6l2 UTSW 7 126953743 missense possibly damaging 0.94
R7228:Sez6l2 UTSW 7 126953725 missense probably damaging 1.00
R7479:Sez6l2 UTSW 7 126963659 missense probably damaging 1.00
R7502:Sez6l2 UTSW 7 126961743 missense probably benign 0.26
Z1176:Sez6l2 UTSW 7 126958331 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCTCCCAAAGCCAAATGTCTGTG -3'
(R):5'- CCAGGCCCTGGGTTTCAATGTTTC -3'

Sequencing Primer
(F):5'- tggaaggctgaggaaagaag -3'
(R):5'- AGCTTCAGGGGCAGTCTTC -3'
Posted On2014-03-28