Incidental Mutation 'R1493:Gm4559'
ID165552
Institutional Source Beutler Lab
Gene Symbol Gm4559
Ensembl Gene ENSMUSG00000056885
Gene Namepredicted gene 4559
Synonyms
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R1493 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location142273764-142274363 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 142274313 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 17 (C17*)
Ref Sequence ENSEMBL: ENSMUSP00000079498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080669]
Predicted Effect probably null
Transcript: ENSMUST00000080669
AA Change: C17*
SMART Domains Protein: ENSMUSP00000079498
Gene: ENSMUSG00000056885
AA Change: C17*

DomainStartEndE-ValueType
low complexity region 3 199 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Gm4559
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03184:Gm4559 APN 7 142274309 missense unknown
R1879:Gm4559 UTSW 7 142274261 missense unknown
R2299:Gm4559 UTSW 7 142273835 missense unknown
R2330:Gm4559 UTSW 7 142274096 missense unknown
R2495:Gm4559 UTSW 7 142273820 missense unknown
R6475:Gm4559 UTSW 7 142274150 missense unknown
R6785:Gm4559 UTSW 7 142274108 missense unknown
R7576:Gm4559 UTSW 7 142273940 missense unknown
R7651:Gm4559 UTSW 7 142273816 missense unknown
R7837:Gm4559 UTSW 7 142273816 missense unknown
R7920:Gm4559 UTSW 7 142273816 missense unknown
W0251:Gm4559 UTSW 7 142273798 missense unknown
Z1177:Gm4559 UTSW 7 142274034 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCAGCAGCTAGATTGACAGCAG -3'
(R):5'- CTGGGCATCTTCTGATGGACACTTG -3'

Sequencing Primer
(F):5'- ttgacagcaggaagacccac -3'
(R):5'- TGCACAAGAGAATCCTAAGCTATG -3'
Posted On2014-03-28