Incidental Mutation 'R1493:Nsd3'
ID165554
Institutional Source Beutler Lab
Gene Symbol Nsd3
Ensembl Gene ENSMUSG00000054823
Gene Namenuclear receptor binding SET domain protein 3
SynonymsWhsc1l1, WHISTLE
MMRRC Submission 039544-MU
Accession Numbers

Genbank: NM_001081269, NM_001001735.1; MGI: 2142581; Ensemb: ENSMUST00000155861, ENSMUST00000146919, ENSMUST00000142395, ENSMUST00000139966, ENSMUST00000153597, ENSMUST00000084026, ENSMUST0000017135

Is this an essential gene? Possibly essential (E-score: 0.507) question?
Stock #R1493 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25601601-25719667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25713380 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1307 (D1307G)
Ref Sequence ENSEMBL: ENSMUSP00000117778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084026] [ENSMUST00000139966] [ENSMUST00000142395] [ENSMUST00000153597]
Predicted Effect probably benign
Transcript: ENSMUST00000084026
AA Change: D1307G

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000081040
Gene: ENSMUSG00000054823
AA Change: D1307G

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139966
AA Change: D1258G

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000122096
Gene: ENSMUSG00000054823
AA Change: D1258G

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 914 5.24e-8 SMART
PWWP 919 981 8.62e-18 SMART
AWS 1054 1105 2.61e-17 SMART
SET 1106 1229 2.17e-41 SMART
PostSET 1230 1246 2.63e-3 SMART
low complexity region 1260 1277 N/A INTRINSIC
PHD 1283 1326 4.32e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142395
AA Change: D1307G

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117778
Gene: ENSMUSG00000054823
AA Change: D1307G

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153597
AA Change: D345G

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123028
Gene: ENSMUSG00000054823
AA Change: D345G

DomainStartEndE-ValueType
PWWP 17 79 8.62e-18 SMART
AWS 152 203 2.61e-17 SMART
SET 204 327 2.17e-41 SMART
PostSET 328 344 2.63e-3 SMART
low complexity region 358 375 N/A INTRINSIC
PHD 381 424 4.32e-9 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the SET domain family of histone lysine N-methyltransferase proteins. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. It acts in opposition to the histone demethylase Jmjd1c. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Nsd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Nsd3 APN 8 25676712 missense probably benign 0.40
IGL00718:Nsd3 APN 8 25706534 missense probably damaging 0.97
IGL00727:Nsd3 APN 8 25641158 missense probably damaging 1.00
IGL01324:Nsd3 APN 8 25662820 missense probably damaging 1.00
IGL01614:Nsd3 APN 8 25666079 missense possibly damaging 0.65
IGL01834:Nsd3 APN 8 25640652 missense probably damaging 1.00
IGL02066:Nsd3 APN 8 25713488 missense probably damaging 1.00
IGL02229:Nsd3 APN 8 25710748 missense probably damaging 0.98
IGL02481:Nsd3 APN 8 25691116 missense probably damaging 1.00
IGL02686:Nsd3 APN 8 25666070 missense probably damaging 0.96
IGL03394:Nsd3 APN 8 25675749 splice site probably benign
Pine UTSW 8 25679936 missense possibly damaging 0.87
D3080:Nsd3 UTSW 8 25713545 missense possibly damaging 0.77
IGL02802:Nsd3 UTSW 8 25640906 missense probably damaging 1.00
R0136:Nsd3 UTSW 8 25659854 nonsense probably null
R0195:Nsd3 UTSW 8 25680693 missense probably damaging 1.00
R0207:Nsd3 UTSW 8 25683257 missense probably benign 0.02
R0471:Nsd3 UTSW 8 25648434 splice site probably benign
R0511:Nsd3 UTSW 8 25678716 missense possibly damaging 0.81
R0524:Nsd3 UTSW 8 25700577 missense possibly damaging 0.90
R0581:Nsd3 UTSW 8 25710691 missense probably damaging 1.00
R0589:Nsd3 UTSW 8 25641287 missense probably damaging 1.00
R0645:Nsd3 UTSW 8 25709069 missense probably benign 0.08
R0664:Nsd3 UTSW 8 25714240 missense probably damaging 0.97
R0738:Nsd3 UTSW 8 25678709 splice site probably null
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1265:Nsd3 UTSW 8 25682562 missense probably benign
R1298:Nsd3 UTSW 8 25679936 missense possibly damaging 0.87
R1424:Nsd3 UTSW 8 25700566 missense probably damaging 1.00
R1528:Nsd3 UTSW 8 25698767 missense probably damaging 1.00
R2051:Nsd3 UTSW 8 25691089 missense probably damaging 0.99
R2199:Nsd3 UTSW 8 25666057 missense probably damaging 0.99
R3414:Nsd3 UTSW 8 25700019 missense probably damaging 1.00
R3522:Nsd3 UTSW 8 25706614 missense probably benign
R3623:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3624:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3798:Nsd3 UTSW 8 25698845 missense probably damaging 1.00
R4345:Nsd3 UTSW 8 25641317 missense probably benign 0.04
R4370:Nsd3 UTSW 8 25648508 missense probably benign 0.13
R4421:Nsd3 UTSW 8 25641272 missense probably damaging 0.99
R4583:Nsd3 UTSW 8 25710676 missense probably benign 0.20
R4664:Nsd3 UTSW 8 25698866 missense probably damaging 1.00
R4741:Nsd3 UTSW 8 25673366 missense probably damaging 1.00
R4876:Nsd3 UTSW 8 25691134 missense possibly damaging 0.94
R4888:Nsd3 UTSW 8 25698911 missense probably damaging 1.00
R5000:Nsd3 UTSW 8 25682577 missense probably damaging 1.00
R5132:Nsd3 UTSW 8 25678839 missense possibly damaging 0.73
R5632:Nsd3 UTSW 8 25679969 missense probably benign 0.00
R5760:Nsd3 UTSW 8 25659756 missense probably damaging 1.00
R5778:Nsd3 UTSW 8 25659818 missense probably damaging 1.00
R5779:Nsd3 UTSW 8 25682669 nonsense probably null
R5860:Nsd3 UTSW 8 25666091 missense probably damaging 0.98
R5911:Nsd3 UTSW 8 25666076 missense probably damaging 1.00
R6168:Nsd3 UTSW 8 25691161 missense probably null 1.00
R6467:Nsd3 UTSW 8 25640630 missense probably damaging 1.00
R6490:Nsd3 UTSW 8 25714185 missense probably damaging 1.00
R6519:Nsd3 UTSW 8 25662939 missense probably damaging 1.00
R6554:Nsd3 UTSW 8 25662875 missense probably damaging 0.99
R7038:Nsd3 UTSW 8 25641263 missense probably damaging 1.00
R7088:Nsd3 UTSW 8 25666034 missense probably benign 0.40
R7244:Nsd3 UTSW 8 25666039 missense probably damaging 0.96
R7308:Nsd3 UTSW 8 25640724 missense probably damaging 1.00
R7678:Nsd3 UTSW 8 25659817 missense possibly damaging 0.82
R7717:Nsd3 UTSW 8 25682562 missense probably benign
R8064:Nsd3 UTSW 8 25700670 nonsense probably null
X0026:Nsd3 UTSW 8 25700593 missense probably damaging 1.00
Z1088:Nsd3 UTSW 8 25641002 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GTTGACAGGCTGCTGTACTCACTG -3'
(R):5'- ACCACATGAGGTACACGTCATTTGC -3'

Sequencing Primer
(F):5'- ACATGCAGAGATGCACAGGT -3'
(R):5'- GCAATGTATCCCAAATCAGTGGTG -3'
Posted On2014-03-28