Incidental Mutation 'R1493:Tmprss13'
ID165559
Institutional Source Beutler Lab
Gene Symbol Tmprss13
Ensembl Gene ENSMUSG00000037129
Gene Nametransmembrane protease, serine 13
Synonyms
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1493 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location45319100-45347581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45336107 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 256 (T256A)
Ref Sequence ENSEMBL: ENSMUSP00000034597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034597]
Predicted Effect probably benign
Transcript: ENSMUST00000034597
AA Change: T256A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000034597
Gene: ENSMUSG00000037129
AA Change: T256A

DomainStartEndE-ValueType
low complexity region 15 99 N/A INTRINSIC
low complexity region 114 128 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
LDLa 171 209 2.38e-1 SMART
SR 208 296 5.67e-4 SMART
Tryp_SPc 306 535 1.53e-93 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease family. Transmembrane serine proteases are regulated by protease inhibitors and known to function in development, homeostasis, infection, and tumorigenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and outwardly healthy but exhibit abnormal stratum corneum formation leading to impaired skin barrier function, as measured by the transepidermal fluid loss rate in newborn pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Tmprss13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Tmprss13 APN 9 45336105 missense probably damaging 0.99
IGL02112:Tmprss13 APN 9 45339404 missense probably damaging 1.00
IGL02116:Tmprss13 APN 9 45333674 missense probably benign
IGL02669:Tmprss13 APN 9 45332526 missense probably benign 0.18
IGL02961:Tmprss13 APN 9 45345003 missense probably damaging 1.00
FR4449:Tmprss13 UTSW 9 45328558 missense unknown
R0233:Tmprss13 UTSW 9 45337100 splice site probably benign
R0271:Tmprss13 UTSW 9 45333688 splice site probably benign
R0415:Tmprss13 UTSW 9 45337132 intron probably null
R0742:Tmprss13 UTSW 9 45332467 missense probably damaging 0.98
R1178:Tmprss13 UTSW 9 45328647 missense unknown
R1447:Tmprss13 UTSW 9 45328580 missense unknown
R1574:Tmprss13 UTSW 9 45343231 missense probably damaging 1.00
R1574:Tmprss13 UTSW 9 45343231 missense probably damaging 1.00
R1599:Tmprss13 UTSW 9 45338318 missense probably damaging 1.00
R2007:Tmprss13 UTSW 9 45332545 missense probably damaging 1.00
R2093:Tmprss13 UTSW 9 45345042 missense probably damaging 0.99
R5666:Tmprss13 UTSW 9 45344955 missense probably damaging 0.99
R5670:Tmprss13 UTSW 9 45344955 missense probably damaging 0.99
R6273:Tmprss13 UTSW 9 45345332 missense probably damaging 1.00
R6343:Tmprss13 UTSW 9 45343200 missense possibly damaging 0.66
R6583:Tmprss13 UTSW 9 45345305 missense probably damaging 1.00
R6671:Tmprss13 UTSW 9 45343231 missense probably damaging 1.00
R6777:Tmprss13 UTSW 9 45336101 nonsense probably null
R7135:Tmprss13 UTSW 9 45338345 missense probably damaging 1.00
R7468:Tmprss13 UTSW 9 45328423 missense unknown
R7617:Tmprss13 UTSW 9 45333560 nonsense probably null
R8062:Tmprss13 UTSW 9 45328688 missense unknown
RF009:Tmprss13 UTSW 9 45328464 small insertion probably benign
RF039:Tmprss13 UTSW 9 45328464 small insertion probably benign
S24628:Tmprss13 UTSW 9 45337132 intron probably null
Z1177:Tmprss13 UTSW 9 45337090 critical splice donor site probably null
Z1177:Tmprss13 UTSW 9 45343192 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGAGCTACTGAGCCAGTTGTAGGG -3'
(R):5'- TTAGCGATTAGGAGGCGGGATCAC -3'

Sequencing Primer
(F):5'- CCAGTTGTAGGGCTGGTAG -3'
(R):5'- GAGCTTTTAAGCCCAAGCTG -3'
Posted On2014-03-28