Incidental Mutation 'R1493:Hs3st5'
ID165565
Institutional Source Beutler Lab
Gene Symbol Hs3st5
Ensembl Gene ENSMUSG00000044499
Gene Nameheparan sulfate (glucosamine) 3-O-sulfotransferase 5
SynonymsLOC382362, D930005L05Rik
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1493 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location36506814-36834397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36832874 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 135 (G135D)
Ref Sequence ENSEMBL: ENSMUSP00000129434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058738] [ENSMUST00000167191] [ENSMUST00000168572]
Predicted Effect probably damaging
Transcript: ENSMUST00000058738
AA Change: G135D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060229
Gene: ENSMUSG00000044499
AA Change: G135D

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sulfotransfer_1 90 339 5.5e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167191
AA Change: G135D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130778
Gene: ENSMUSG00000044499
AA Change: G135D

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sulfotransfer_1 90 339 5.5e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168572
AA Change: G135D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129434
Gene: ENSMUSG00000044499
AA Change: G135D

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sulfotransfer_1 90 339 5.5e-38 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HS3ST5 belongs to a group of heparan sulfate 3-O-sulfotransferases (EC 2.8.2.23) that transfer sulfate from 3-prime-phosphoadenosine 5-prime phosphosulfate (PAPS) to heparan sulfate and heparin (Mochizuki et al., 2003 [PubMed 12740361]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Hs3st5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Hs3st5 APN 10 36832922 missense probably benign 0.02
IGL00913:Hs3st5 APN 10 36832850 missense probably damaging 1.00
IGL01407:Hs3st5 APN 10 36833408 missense probably damaging 1.00
IGL01516:Hs3st5 APN 10 36833051 missense probably damaging 1.00
IGL02396:Hs3st5 APN 10 36828703 start codon destroyed probably benign 0.08
IGL03351:Hs3st5 APN 10 36833323 missense probably damaging 1.00
R0606:Hs3st5 UTSW 10 36832588 missense probably benign 0.00
R1412:Hs3st5 UTSW 10 36832676 missense probably benign 0.02
R1443:Hs3st5 UTSW 10 36833414 missense probably benign 0.35
R1768:Hs3st5 UTSW 10 36833169 missense probably benign 0.01
R1792:Hs3st5 UTSW 10 36832724 missense probably benign
R1991:Hs3st5 UTSW 10 36832886 missense probably damaging 1.00
R1992:Hs3st5 UTSW 10 36832886 missense probably damaging 1.00
R4330:Hs3st5 UTSW 10 36832730 missense probably benign 0.06
R4610:Hs3st5 UTSW 10 36828806 missense probably benign 0.26
R5459:Hs3st5 UTSW 10 36828746 missense possibly damaging 0.85
R5561:Hs3st5 UTSW 10 36833429 missense probably damaging 1.00
R6005:Hs3st5 UTSW 10 36832928 missense probably damaging 1.00
R7082:Hs3st5 UTSW 10 36832837 missense probably benign 0.01
R7326:Hs3st5 UTSW 10 36833194 missense probably damaging 1.00
R7507:Hs3st5 UTSW 10 36833015 missense probably damaging 1.00
R7885:Hs3st5 UTSW 10 36828780 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCTGGCACAGATGCAGAATG -3'
(R):5'- GTCGGCTCCCTGACAATGATCAAC -3'

Sequencing Primer
(F):5'- ATTTGGTGGTGCCCACAAC -3'
(R):5'- CCTGACAATGATCAACAGCTTGATG -3'
Posted On2014-03-28