Incidental Mutation 'R1493:Cep290'
ID165566
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Namecentrosomal protein 290
Synonymsb2b1454Clo, Nphp6, b2b1752Clo
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R1493 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location100487558-100574840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100562181 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 2200 (T2200S)
Ref Sequence ENSEMBL: ENSMUSP00000151388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]
Predicted Effect probably benign
Transcript: ENSMUST00000164751
AA Change: T2200S

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: T2200S

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219643
Predicted Effect probably benign
Transcript: ENSMUST00000219765
AA Change: T2193S

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000220346
AA Change: T2200S

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100508724 missense probably benign 0.00
IGL00499:Cep290 APN 10 100543327 missense probably damaging 1.00
IGL00547:Cep290 APN 10 100510708 missense probably damaging 0.99
IGL00573:Cep290 APN 10 100540361 missense probably damaging 1.00
IGL00646:Cep290 APN 10 100501154 missense probably benign 0.15
IGL00755:Cep290 APN 10 100531104 missense probably damaging 1.00
IGL00835:Cep290 APN 10 100563380 nonsense probably null
IGL00846:Cep290 APN 10 100540333 splice site probably benign
IGL00985:Cep290 APN 10 100567161 splice site probably benign
IGL01687:Cep290 APN 10 100500205 missense probably damaging 1.00
IGL01782:Cep290 APN 10 100545125 nonsense probably null
IGL02010:Cep290 APN 10 100508707 missense probably benign 0.39
IGL02010:Cep290 APN 10 100561345 missense probably benign 0.00
IGL02036:Cep290 APN 10 100558100 nonsense probably null
IGL02039:Cep290 APN 10 100514602 critical splice donor site probably null
IGL02532:Cep290 APN 10 100545065 missense probably benign 0.04
IGL02950:Cep290 APN 10 100540329 splice site probably benign
IGL03105:Cep290 APN 10 100551824 missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100568088 missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100537801 missense probably benign 0.09
IGL03401:Cep290 APN 10 100500265 missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100537591 missense probably benign 0.28
R0025:Cep290 UTSW 10 100537831 missense probably damaging 1.00
R0127:Cep290 UTSW 10 100536925 splice site probably benign
R0254:Cep290 UTSW 10 100514574 missense probably benign 0.31
R0295:Cep290 UTSW 10 100537821 missense probably damaging 0.99
R0371:Cep290 UTSW 10 100518564 splice site probably benign
R0390:Cep290 UTSW 10 100508758 missense probably benign 0.09
R0399:Cep290 UTSW 10 100554400 splice site probably benign
R0413:Cep290 UTSW 10 100523314 nonsense probably null
R0427:Cep290 UTSW 10 100516179 missense probably benign 0.01
R0472:Cep290 UTSW 10 100551455 missense probably benign 0.19
R0485:Cep290 UTSW 10 100549344 missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100492676 missense probably damaging 1.00
R0675:Cep290 UTSW 10 100568813 critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100518762 missense probably benign 0.08
R1238:Cep290 UTSW 10 100517863 missense probably damaging 1.00
R1297:Cep290 UTSW 10 100539100 splice site probably benign
R1368:Cep290 UTSW 10 100494966 splice site probably benign
R1394:Cep290 UTSW 10 100537529 missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100572101 missense probably benign 0.00
R1496:Cep290 UTSW 10 100538966 missense probably damaging 1.00
R1539:Cep290 UTSW 10 100496828 missense probably benign 0.06
R1598:Cep290 UTSW 10 100549329 missense probably damaging 1.00
R1616:Cep290 UTSW 10 100568836 missense probably benign
R1712:Cep290 UTSW 10 100554499 missense probably benign 0.02
R1753:Cep290 UTSW 10 100513981 missense probably benign
R1773:Cep290 UTSW 10 100510573 missense probably benign
R1775:Cep290 UTSW 10 100496810 missense probably damaging 0.98
R1799:Cep290 UTSW 10 100516196 missense probably benign 0.00
R1937:Cep290 UTSW 10 100497953 missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100531184 missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100512400 critical splice donor site probably null
R2164:Cep290 UTSW 10 100518795 missense probably damaging 0.96
R2393:Cep290 UTSW 10 100561238 critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100537437 missense probably benign 0.19
R3612:Cep290 UTSW 10 100541581 nonsense probably null
R3800:Cep290 UTSW 10 100572941 missense probably damaging 0.97
R4005:Cep290 UTSW 10 100539008 missense probably damaging 1.00
R4039:Cep290 UTSW 10 100512401 critical splice donor site probably null
R4259:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4260:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4319:Cep290 UTSW 10 100539047 missense probably benign 0.09
R4329:Cep290 UTSW 10 100537668 missense probably damaging 0.98
R4573:Cep290 UTSW 10 100518850 missense probably benign
R4614:Cep290 UTSW 10 100508740 missense probably benign
R4614:Cep290 UTSW 10 100559687 missense possibly damaging 0.93
R4708:Cep290 UTSW 10 100523264 missense probably benign 0.02
R4727:Cep290 UTSW 10 100563270 missense probably benign 0.05
R4825:Cep290 UTSW 10 100488348 missense probably damaging 0.96
R4839:Cep290 UTSW 10 100508786 missense probably damaging 0.99
R4858:Cep290 UTSW 10 100494911 missense probably benign 0.31
R4871:Cep290 UTSW 10 100548914 missense probably benign 0.22
R5094:Cep290 UTSW 10 100567030 missense probably damaging 0.97
R5103:Cep290 UTSW 10 100539020 missense probably damaging 1.00
R5499:Cep290 UTSW 10 100537653 missense probably damaging 0.99
R5505:Cep290 UTSW 10 100499186 critical splice donor site probably null
R5615:Cep290 UTSW 10 100531150 missense probably damaging 1.00
R5815:Cep290 UTSW 10 100558108 missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100523399 missense probably benign 0.44
R5889:Cep290 UTSW 10 100499074 missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100551830 missense probably damaging 0.99
R5992:Cep290 UTSW 10 100543321 missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100541787 missense probably damaging 1.00
R6213:Cep290 UTSW 10 100523360 missense probably benign 0.06
R6274:Cep290 UTSW 10 100530207 missense probably damaging 1.00
R6285:Cep290 UTSW 10 100523329 missense probably benign 0.17
R6306:Cep290 UTSW 10 100531166 missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100508776 missense probably benign 0.01
R6649:Cep290 UTSW 10 100518531 missense probably benign 0.28
R6692:Cep290 UTSW 10 100569144 intron probably null
R6788:Cep290 UTSW 10 100488628 missense probably damaging 1.00
R6847:Cep290 UTSW 10 100563419 missense probably damaging 1.00
R6947:Cep290 UTSW 10 100530056 missense probably damaging 1.00
R7035:Cep290 UTSW 10 100499071 missense probably benign 0.07
R7073:Cep290 UTSW 10 100539003 missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100543358 missense probably damaging 0.98
R7256:Cep290 UTSW 10 100546498 missense probably damaging 1.00
R7258:Cep290 UTSW 10 100499108 missense probably benign 0.01
R7311:Cep290 UTSW 10 100537718 missense probably damaging 0.98
R7505:Cep290 UTSW 10 100516265 missense probably benign 0.01
R7615:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7643:Cep290 UTSW 10 100537553 missense probably benign
R7662:Cep290 UTSW 10 100537803 missense probably benign 0.21
R7663:Cep290 UTSW 10 100554536 critical splice donor site probably null
R7685:Cep290 UTSW 10 100540057 missense probably benign 0.19
R7717:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7747:Cep290 UTSW 10 100558176 nonsense probably null
R7757:Cep290 UTSW 10 100563434 missense probably benign
R7843:Cep290 UTSW 10 100516188 missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100554490 missense probably benign
R7926:Cep290 UTSW 10 100516188 missense possibly damaging 0.49
R7988:Cep290 UTSW 10 100554490 missense probably benign
Z1176:Cep290 UTSW 10 100549374 critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100497944 missense probably benign
Z1177:Cep290 UTSW 10 100538997 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACCTCACCTCCTTTCACATGGATCA -3'
(R):5'- ACATAAACCACCCGGTCCTAAATTTTCA -3'

Sequencing Primer
(F):5'- TGCATAAAGACATAGCTACAACTTGC -3'
(R):5'- AGACACTGGTGTCAAAGATCTATC -3'
Posted On2014-03-28