Incidental Mutation 'R1493:Ehbp1'
ID165569
Institutional Source Beutler Lab
Gene Symbol Ehbp1
Ensembl Gene ENSMUSG00000042302
Gene NameEH domain binding protein 1
SynonymsKIAA0903-like, Flj21950
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.705) question?
Stock #R1493 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location22005828-22342292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22006866 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 1204 (E1204V)
Ref Sequence ENSEMBL: ENSMUSP00000105191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045167] [ENSMUST00000109563] [ENSMUST00000147486] [ENSMUST00000180360]
Predicted Effect probably damaging
Transcript: ENSMUST00000045167
AA Change: E1179V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037489
Gene: ENSMUSG00000042302
AA Change: E1179V

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109563
AA Change: E1204V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105191
Gene: ENSMUSG00000042302
AA Change: E1204V

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 1.3e-29 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 357 368 N/A INTRINSIC
low complexity region 399 417 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
CH 455 553 1.42e-15 SMART
Blast:CH 782 851 3e-12 BLAST
low complexity region 854 875 N/A INTRINSIC
low complexity region 908 923 N/A INTRINSIC
DUF3585 1068 1212 4.25e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147486
SMART Domains Protein: ENSMUSP00000134704
Gene: ENSMUSG00000005917

DomainStartEndE-ValueType
HOX 38 100 1.21e-25 SMART
low complexity region 117 125 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000180360
AA Change: E1179V

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136697
Gene: ENSMUSG00000042302
AA Change: E1179V

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Eps15 homology domain binding protein. The encoded protein may play a role in endocytic trafficking. A single nucleotide polymorphism in this gene is associated with an aggressive form of prostate cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Ehbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ehbp1 APN 11 22247967 splice site probably benign
IGL00786:Ehbp1 APN 11 22100460 missense possibly damaging 0.79
IGL01308:Ehbp1 APN 11 22138022 missense probably damaging 1.00
IGL01322:Ehbp1 APN 11 22089636 missense probably damaging 1.00
IGL01590:Ehbp1 APN 11 22095611 missense possibly damaging 0.91
IGL01611:Ehbp1 APN 11 22172883 missense probably damaging 0.98
IGL01636:Ehbp1 APN 11 22089584 missense probably benign 0.03
IGL01728:Ehbp1 APN 11 22101115 missense probably damaging 1.00
IGL02012:Ehbp1 APN 11 22101218 missense probably damaging 1.00
IGL02034:Ehbp1 APN 11 22285486 critical splice donor site probably null
IGL02324:Ehbp1 APN 11 22096048 missense probably damaging 1.00
IGL02511:Ehbp1 APN 11 22089653 missense probably damaging 1.00
trajan UTSW 11 22151850 missense probably damaging 1.00
K7894:Ehbp1 UTSW 11 22089683 splice site probably benign
PIT4418001:Ehbp1 UTSW 11 22053494 missense probably damaging 1.00
R0218:Ehbp1 UTSW 11 22231992 splice site probably benign
R0294:Ehbp1 UTSW 11 22095427 missense probably benign 0.27
R0398:Ehbp1 UTSW 11 22095886 missense probably damaging 0.99
R0420:Ehbp1 UTSW 11 22151836 missense probably benign
R0468:Ehbp1 UTSW 11 22169184 splice site probably benign
R0943:Ehbp1 UTSW 11 22095883 missense probably benign 0.12
R1181:Ehbp1 UTSW 11 22062831 missense probably benign 0.25
R1481:Ehbp1 UTSW 11 22006782 makesense probably null
R1563:Ehbp1 UTSW 11 22059231 missense probably damaging 1.00
R1648:Ehbp1 UTSW 11 22096000 missense probably damaging 1.00
R1656:Ehbp1 UTSW 11 22146694 missense probably benign
R1696:Ehbp1 UTSW 11 22053441 missense probably damaging 0.99
R1923:Ehbp1 UTSW 11 22151850 missense probably damaging 1.00
R1950:Ehbp1 UTSW 11 22059228 missense probably damaging 1.00
R2263:Ehbp1 UTSW 11 22095462 missense probably benign
R2436:Ehbp1 UTSW 11 22089524 critical splice donor site probably null
R3148:Ehbp1 UTSW 11 22100465 missense probably damaging 1.00
R3973:Ehbp1 UTSW 11 22137867 missense probably benign 0.00
R3974:Ehbp1 UTSW 11 22137867 missense probably benign 0.00
R4030:Ehbp1 UTSW 11 22285498 missense probably damaging 1.00
R4085:Ehbp1 UTSW 11 22095898 missense possibly damaging 0.95
R4089:Ehbp1 UTSW 11 22095898 missense possibly damaging 0.95
R4524:Ehbp1 UTSW 11 22151843 missense probably damaging 1.00
R4641:Ehbp1 UTSW 11 22095892 missense probably benign 0.00
R4873:Ehbp1 UTSW 11 22101164 missense probably damaging 1.00
R4875:Ehbp1 UTSW 11 22101164 missense probably damaging 1.00
R4914:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4915:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4916:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4917:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4918:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4929:Ehbp1 UTSW 11 22239169 missense possibly damaging 0.48
R4995:Ehbp1 UTSW 11 22101073 missense probably damaging 1.00
R5325:Ehbp1 UTSW 11 22095370 missense possibly damaging 0.93
R5579:Ehbp1 UTSW 11 22137846 missense probably damaging 1.00
R5979:Ehbp1 UTSW 11 22151887 missense probably benign 0.06
R6025:Ehbp1 UTSW 11 22239156 missense probably damaging 1.00
R6259:Ehbp1 UTSW 11 22285684 start gained probably benign
R6685:Ehbp1 UTSW 11 22146641 missense probably benign 0.01
R6893:Ehbp1 UTSW 11 22014945 missense probably damaging 1.00
R7127:Ehbp1 UTSW 11 22053529 nonsense probably null
R7465:Ehbp1 UTSW 11 22138001 missense probably benign
R7722:Ehbp1 UTSW 11 22089572 missense probably null
R7724:Ehbp1 UTSW 11 22089572 missense probably null
R7797:Ehbp1 UTSW 11 22096109 missense possibly damaging 0.79
R7868:Ehbp1 UTSW 11 22146542 nonsense probably null
R7951:Ehbp1 UTSW 11 22146542 nonsense probably null
RF016:Ehbp1 UTSW 11 22146646 missense probably benign
RF037:Ehbp1 UTSW 11 22006783 small deletion probably benign
X0018:Ehbp1 UTSW 11 22101085 missense probably damaging 1.00
Z1176:Ehbp1 UTSW 11 22095590 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCATCTTCAGTACCAGTCATTCACG -3'
(R):5'- GTTCATTTCGGGAATCTGAGAGGTCC -3'

Sequencing Primer
(F):5'- CGCAAATCTACTTCACAGGATTTC -3'
(R):5'- AATCTGAGAGGTCCGGTGC -3'
Posted On2014-03-28