Incidental Mutation 'R1493:Zfp692'
ID165570
Institutional Source Beutler Lab
Gene Symbol Zfp692
Ensembl Gene ENSMUSG00000037243
Gene Namezinc finger protein 692
SynonymsZfp692-ps
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1493 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58307069-58314627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58314040 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 409 (I409F)
Ref Sequence ENSEMBL: ENSMUSP00000131896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049353] [ENSMUST00000057836] [ENSMUST00000064786] [ENSMUST00000108829] [ENSMUST00000153510] [ENSMUST00000155662] [ENSMUST00000186859]
Predicted Effect probably damaging
Transcript: ENSMUST00000049353
AA Change: I409F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131896
Gene: ENSMUSG00000037243
AA Change: I409F

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
low complexity region 159 175 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
ZnF_C2H2 327 352 4.11e-2 SMART
ZnF_C2H2 358 382 2.05e-2 SMART
ZnF_C2H2 388 410 1.69e-3 SMART
ZnF_C2H2 416 438 1.69e-3 SMART
ZnF_C2H2 447 470 6.23e-2 SMART
low complexity region 502 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057836
SMART Domains Protein: ENSMUSP00000060088
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
ZnF_C2H2 43 65 8.75e0 SMART
ZnF_C2H2 71 93 1.18e-2 SMART
ZnF_C2H2 100 123 1.76e-1 SMART
ZnF_C2H2 129 151 1.59e1 SMART
ZnF_C2H2 167 189 4.47e-3 SMART
ZnF_C2H2 202 224 9.58e-3 SMART
ZnF_C2H2 230 252 7.37e-4 SMART
ZnF_C2H2 258 280 3.16e-3 SMART
ZnF_C2H2 286 308 1.45e-2 SMART
ZnF_C2H2 314 336 4.01e-5 SMART
ZnF_C2H2 342 364 5.5e-3 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
ZnF_C2H2 398 420 6.67e-2 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064786
SMART Domains Protein: ENSMUSP00000070567
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
ZnF_C2H2 43 65 8.75e0 SMART
ZnF_C2H2 71 93 1.18e-2 SMART
ZnF_C2H2 100 123 1.76e-1 SMART
ZnF_C2H2 129 151 1.59e1 SMART
ZnF_C2H2 167 189 4.47e-3 SMART
ZnF_C2H2 202 224 9.58e-3 SMART
ZnF_C2H2 230 252 7.37e-4 SMART
ZnF_C2H2 258 280 3.16e-3 SMART
ZnF_C2H2 286 308 1.45e-2 SMART
ZnF_C2H2 314 336 4.01e-5 SMART
ZnF_C2H2 342 364 5.5e-3 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
ZnF_C2H2 398 420 6.67e-2 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108829
SMART Domains Protein: ENSMUSP00000104457
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
ZnF_C2H2 43 65 8.75e0 SMART
ZnF_C2H2 71 93 1.18e-2 SMART
ZnF_C2H2 100 123 1.76e-1 SMART
ZnF_C2H2 129 151 1.59e1 SMART
ZnF_C2H2 167 189 4.47e-3 SMART
ZnF_C2H2 202 224 9.58e-3 SMART
ZnF_C2H2 230 252 7.37e-4 SMART
ZnF_C2H2 258 280 3.16e-3 SMART
ZnF_C2H2 286 308 1.45e-2 SMART
ZnF_C2H2 314 336 4.01e-5 SMART
ZnF_C2H2 342 364 5.5e-3 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
ZnF_C2H2 398 420 6.67e-2 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153510
AA Change: I409F

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126674
Gene: ENSMUSG00000037243
AA Change: I409F

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
low complexity region 159 175 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
ZnF_C2H2 327 352 4.11e-2 SMART
ZnF_C2H2 358 382 2.05e-2 SMART
ZnF_C2H2 388 410 1.69e-3 SMART
ZnF_C2H2 416 438 1.69e-3 SMART
ZnF_C2H2 447 470 6.23e-2 SMART
low complexity region 502 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155662
SMART Domains Protein: ENSMUSP00000114561
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186859
SMART Domains Protein: ENSMUSP00000140236
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 1.8e-5 SMART
ZnF_C2H2 43 65 3.6e-2 SMART
ZnF_C2H2 71 90 6.1e-1 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Zfp692
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Zfp692 APN 11 58314029 missense possibly damaging 0.94
IGL00978:Zfp692 APN 11 58309998 missense possibly damaging 0.92
IGL01667:Zfp692 APN 11 58311553 missense probably damaging 1.00
IGL02209:Zfp692 APN 11 58313998 nonsense probably null
IGL02873:Zfp692 APN 11 58308939 missense probably damaging 1.00
R0255:Zfp692 UTSW 11 58310403 splice site probably benign
R0267:Zfp692 UTSW 11 58314314 missense possibly damaging 0.64
R0506:Zfp692 UTSW 11 58309055 nonsense probably null
R0554:Zfp692 UTSW 11 58314227 missense probably damaging 1.00
R0628:Zfp692 UTSW 11 58309623 missense probably damaging 1.00
R0712:Zfp692 UTSW 11 58314314 missense probably benign 0.00
R1112:Zfp692 UTSW 11 58311562 missense probably damaging 1.00
R1768:Zfp692 UTSW 11 58310176 splice site probably benign
R1853:Zfp692 UTSW 11 58309979 missense possibly damaging 0.69
R3551:Zfp692 UTSW 11 58309428 missense possibly damaging 0.52
R3552:Zfp692 UTSW 11 58309428 missense possibly damaging 0.52
R4281:Zfp692 UTSW 11 58314265 missense probably damaging 1.00
R4784:Zfp692 UTSW 11 58310171 missense probably null 0.12
R5150:Zfp692 UTSW 11 58307587 start codon destroyed probably null 0.77
R7035:Zfp692 UTSW 11 58309442 critical splice donor site probably null
R7343:Zfp692 UTSW 11 58311505 missense probably damaging 1.00
R7896:Zfp692 UTSW 11 58314236 missense probably damaging 1.00
R8071:Zfp692 UTSW 11 58307734 missense probably damaging 0.96
R8163:Zfp692 UTSW 11 58310373 splice site probably null
Z1186:Zfp692 UTSW 11 58309033 missense probably benign 0.02
Z1186:Zfp692 UTSW 11 58310018 missense probably benign
Z1187:Zfp692 UTSW 11 58309033 missense probably benign 0.02
Z1187:Zfp692 UTSW 11 58310018 missense probably benign
Z1188:Zfp692 UTSW 11 58309033 missense probably benign 0.02
Z1188:Zfp692 UTSW 11 58310018 missense probably benign
Z1189:Zfp692 UTSW 11 58309033 missense probably benign 0.02
Z1189:Zfp692 UTSW 11 58310018 missense probably benign
Z1190:Zfp692 UTSW 11 58309033 missense probably benign 0.02
Z1190:Zfp692 UTSW 11 58310018 missense probably benign
Z1191:Zfp692 UTSW 11 58309033 missense probably benign 0.02
Z1191:Zfp692 UTSW 11 58310018 missense probably benign
Z1192:Zfp692 UTSW 11 58309033 missense probably benign 0.02
Z1192:Zfp692 UTSW 11 58310018 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTACTGACACCACCTGTTGGGAG -3'
(R):5'- GCAGAAATGCTGGGACTAGACACC -3'

Sequencing Primer
(F):5'- AGTGGTGGGCTAAAACCTG -3'
(R):5'- AGTGAGCTACCACACTGTCTG -3'
Posted On2014-03-28