Incidental Mutation 'R1493:Sorbs3'
ID165580
Institutional Source Beutler Lab
Gene Symbol Sorbs3
Ensembl Gene ENSMUSG00000022091
Gene Namesorbin and SH3 domain containing 3
SynonymsSH3P3, Sh3d4, vinexin beta, vinexin alpha
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1493 (G1)
Quality Score199
Status Not validated
Chromosome14
Chromosomal Location70180468-70211989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70192627 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 353 (T353A)
Ref Sequence ENSEMBL: ENSMUSP00000154773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022682] [ENSMUST00000227259] [ENSMUST00000227653] [ENSMUST00000227929]
Predicted Effect probably benign
Transcript: ENSMUST00000022682
AA Change: T353A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022682
Gene: ENSMUSG00000022091
AA Change: T353A

DomainStartEndE-ValueType
Sorb 165 214 6.87e-30 SMART
SH3 447 502 9.24e-21 SMART
SH3 521 578 4.18e-19 SMART
low complexity region 597 613 N/A INTRINSIC
SH3 677 733 8.31e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227259
AA Change: T300A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000227653
AA Change: T300A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227929
AA Change: T353A

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an SH3 domain-containing adaptor protein. The presence of SH3 domains play a role in this protein's ability to bind other cytoplasmic molecules and contribute to cystoskeletal organization, cell adhesion and migration, signaling, and gene expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutants are generally normal, viable, and fertile, except showing delayed wound healing in response to full-thickness skin injury in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Sorbs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Sorbs3 APN 14 70191155 missense probably damaging 1.00
IGL01144:Sorbs3 APN 14 70191568 missense probably benign 0.04
IGL01155:Sorbs3 APN 14 70199341 missense probably damaging 1.00
IGL01465:Sorbs3 APN 14 70195509 splice site probably benign
IGL02184:Sorbs3 APN 14 70184006 critical splice donor site probably null
R0544:Sorbs3 UTSW 14 70193926 missense probably benign 0.01
R0882:Sorbs3 UTSW 14 70207572 missense probably damaging 1.00
R1445:Sorbs3 UTSW 14 70193646 missense probably benign 0.12
R1505:Sorbs3 UTSW 14 70190802 nonsense probably null
R1671:Sorbs3 UTSW 14 70191466 missense possibly damaging 0.92
R2184:Sorbs3 UTSW 14 70191431 critical splice donor site probably null
R3804:Sorbs3 UTSW 14 70199351 splice site probably benign
R4527:Sorbs3 UTSW 14 70207617 missense probably damaging 1.00
R4755:Sorbs3 UTSW 14 70184099 missense probably benign 0.00
R4926:Sorbs3 UTSW 14 70186945 missense probably damaging 1.00
R5257:Sorbs3 UTSW 14 70185034 missense probably benign 0.00
R5304:Sorbs3 UTSW 14 70184896 nonsense probably null
R5328:Sorbs3 UTSW 14 70181174 missense probably damaging 1.00
R5684:Sorbs3 UTSW 14 70181222 missense probably damaging 1.00
R5988:Sorbs3 UTSW 14 70203303 missense probably benign 0.03
R6106:Sorbs3 UTSW 14 70192604 splice site probably null
R7207:Sorbs3 UTSW 14 70201485 missense probably damaging 1.00
R7562:Sorbs3 UTSW 14 70207527 missense probably benign 0.00
R7831:Sorbs3 UTSW 14 70203032 missense possibly damaging 0.93
R7893:Sorbs3 UTSW 14 70193916 missense probably benign 0.35
R7914:Sorbs3 UTSW 14 70203032 missense possibly damaging 0.93
R7976:Sorbs3 UTSW 14 70193916 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GAGCCGATACACTGAACCAGAGTTG -3'
(R):5'- ACAGGAATGAGGTGTCACCTTCCC -3'

Sequencing Primer
(F):5'- GCCAGGAAGGGTTCTCAG -3'
(R):5'- ATGACTACAGGCATCAGGC -3'
Posted On2014-03-28