Incidental Mutation 'R1493:Abcg8'
ID165587
Institutional Source Beutler Lab
Gene Symbol Abcg8
Ensembl Gene ENSMUSG00000024254
Gene NameATP binding cassette subfamily G member 8
Synonyms1300003C16Rik, Sterolin-2
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1493 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location84676302-84700333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84696679 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 472 (S472P)
Ref Sequence ENSEMBL: ENSMUSP00000126675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045714] [ENSMUST00000170725] [ENSMUST00000171915]
Predicted Effect probably damaging
Transcript: ENSMUST00000045714
AA Change: S473P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035246
Gene: ENSMUSG00000024254
AA Change: S473P

DomainStartEndE-ValueType
Pfam:ABC_tran 89 242 2.1e-29 PFAM
Pfam:ABC2_membrane 397 608 1.7e-36 PFAM
transmembrane domain 640 662 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170725
AA Change: S346P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127785
Gene: ENSMUSG00000024254
AA Change: S346P

DomainStartEndE-ValueType
Pfam:ABC_tran 1 115 2.6e-18 PFAM
Pfam:ABC2_membrane 270 481 7.4e-38 PFAM
transmembrane domain 513 535 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171915
AA Change: S472P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126675
Gene: ENSMUSG00000024254
AA Change: S472P

DomainStartEndE-ValueType
Pfam:ABC_tran 88 241 7.5e-30 PFAM
Pfam:ABC2_membrane 396 607 1.7e-37 PFAM
transmembrane domain 639 661 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. The protein encoded by this gene functions to exclude non-cholesterol sterol entry at the intestinal level, promote excretion of cholesterol and sterols into bile, and to facilitate transport of sterols back into the intestinal lumen. It is expressed in a tissue-specific manner in the liver, intestine, and gallbladder. This gene is tandemly arrayed on chromosome 2, in a head-to-head orientation with family member ABCG5. Mutations in this gene may contribute to sterol accumulation and atherosclerosis, and have been observed in patients with sitosterolemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants fail to secrete cholesterol into bile and exhibit increased plasma and tissue plant sterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Abcg8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Abcg8 APN 17 84688529 splice site probably null
IGL01019:Abcg8 APN 17 84691995 missense probably benign 0.21
IGL02498:Abcg8 APN 17 84683265 missense probably benign
IGL02506:Abcg8 APN 17 84692488 missense possibly damaging 0.84
IGL03077:Abcg8 APN 17 84691880 missense probably damaging 1.00
R0086:Abcg8 UTSW 17 84692771 missense probably damaging 1.00
R0130:Abcg8 UTSW 17 84686666 missense probably damaging 1.00
R0930:Abcg8 UTSW 17 84683277 missense probably benign 0.00
R1466:Abcg8 UTSW 17 84686727 splice site probably benign
R1628:Abcg8 UTSW 17 84691991 nonsense probably null
R1916:Abcg8 UTSW 17 84688530 critical splice acceptor site probably null
R1935:Abcg8 UTSW 17 84694989 splice site probably benign
R1971:Abcg8 UTSW 17 84695159 splice site probably benign
R4638:Abcg8 UTSW 17 84691941 missense probably damaging 1.00
R4693:Abcg8 UTSW 17 84696697 missense probably damaging 1.00
R5182:Abcg8 UTSW 17 84692744 missense probably damaging 1.00
R5227:Abcg8 UTSW 17 84691821 missense probably damaging 1.00
R5621:Abcg8 UTSW 17 84695993 missense probably damaging 0.96
R5772:Abcg8 UTSW 17 84686699 missense probably damaging 1.00
R7315:Abcg8 UTSW 17 84696714 missense probably damaging 0.99
R7709:Abcg8 UTSW 17 84692491 missense probably damaging 0.99
Z1177:Abcg8 UTSW 17 84692006 missense possibly damaging 0.95
Z1177:Abcg8 UTSW 17 84695030 nonsense probably null
Z1177:Abcg8 UTSW 17 84696118 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGAACCCATAGCTTTGCGACG -3'
(R):5'- GAGTATCATTTCTGCCTCACAGCCC -3'

Sequencing Primer
(F):5'- cgacgagtgagcaagtatcc -3'
(R):5'- TCTGGGGACAGTTTAATGGC -3'
Posted On2014-03-28