Incidental Mutation 'R1493:Rnmt'
ID165588
Institutional Source Beutler Lab
Gene Symbol Rnmt
Ensembl Gene ENSMUSG00000009535
Gene NameRNA (guanine-7-) methyltransferase
Synonyms
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1493 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location68300355-68324852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 68313707 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 268 (D268N)
Ref Sequence ENSEMBL: ENSMUSP00000025427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009679] [ENSMUST00000025427] [ENSMUST00000131075] [ENSMUST00000139111]
Predicted Effect probably damaging
Transcript: ENSMUST00000009679
AA Change: D268N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000009679
Gene: ENSMUSG00000009535
AA Change: D268N

DomainStartEndE-ValueType
Pfam:Pox_MCEL 125 464 7.5e-128 PFAM
Pfam:Methyltransf_31 184 352 1.2e-8 PFAM
Pfam:Methyltransf_11 191 305 3.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000025427
AA Change: D268N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025427
Gene: ENSMUSG00000009535
AA Change: D268N

DomainStartEndE-ValueType
Pfam:Pox_MCEL 125 317 2.8e-79 PFAM
Pfam:Methyltransf_23 163 349 8.2e-10 PFAM
Pfam:Methyltransf_31 184 375 4.3e-9 PFAM
Pfam:Methyltransf_18 186 308 1.4e-7 PFAM
Pfam:Methyltransf_11 191 305 5.1e-9 PFAM
Pfam:Pox_MCEL 313 409 2.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131075
SMART Domains Protein: ENSMUSP00000122741
Gene: ENSMUSG00000009535

DomainStartEndE-ValueType
Pfam:Pox_MCEL 125 205 3.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139111
SMART Domains Protein: ENSMUSP00000123500
Gene: ENSMUSG00000009535

DomainStartEndE-ValueType
Pfam:Pox_MCEL 125 240 1.2e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151833
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Ankrd27 C T 7: 35,608,365 S343L probably benign Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Rnmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02231:Rnmt APN 18 68314081 nonsense probably null
talenti UTSW 18 68319214 missense probably damaging 0.98
IGL03098:Rnmt UTSW 18 68306002 missense probably damaging 0.98
R0137:Rnmt UTSW 18 68313700 missense probably benign 0.00
R0712:Rnmt UTSW 18 68307788 critical splice donor site probably null
R1541:Rnmt UTSW 18 68307782 missense probably damaging 1.00
R1606:Rnmt UTSW 18 68311653 missense possibly damaging 0.83
R2224:Rnmt UTSW 18 68305783 start gained probably benign
R3114:Rnmt UTSW 18 68314008 missense probably benign 0.13
R3115:Rnmt UTSW 18 68314008 missense probably benign 0.13
R4424:Rnmt UTSW 18 68311671 missense probably null 0.07
R4705:Rnmt UTSW 18 68314125 missense probably damaging 1.00
R4722:Rnmt UTSW 18 68305881 missense probably damaging 0.98
R4732:Rnmt UTSW 18 68317960 intron probably benign
R5173:Rnmt UTSW 18 68321359 utr 3 prime probably benign
R5523:Rnmt UTSW 18 68313702 missense probably benign
R5579:Rnmt UTSW 18 68306115 missense possibly damaging 0.93
R5966:Rnmt UTSW 18 68311618 missense probably benign 0.16
R6322:Rnmt UTSW 18 68319214 missense probably damaging 0.98
R7149:Rnmt UTSW 18 68319151 missense probably damaging 1.00
R7529:Rnmt UTSW 18 68311655 missense probably benign 0.41
R7620:Rnmt UTSW 18 68314034 missense probably damaging 1.00
Z1088:Rnmt UTSW 18 68307674 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GTCAGGGAACAGCTACTTTAAGAGCC -3'
(R):5'- TATCCCCTACCGTGATCAAAGCCG -3'

Sequencing Primer
(F):5'- CAGCTACTTTAAGAGCCCTAAATTC -3'
(R):5'- GCAGGTCAAGACATTCTTACTCAG -3'
Posted On2014-03-28