Mutagenetix > Incidental Mutation

Incidental Mutation 'R1478:Pikfyve'

165593

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

PipkIII, Pip5k3, 5230400C17Rik

MMRRC Submission

039531-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1478 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65225842-65317854 bp(+) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 65302136 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000095314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]

AlphaFold

Q9Z1T6

Predicted Effect

probably null
Transcript: ENSMUST00000081154

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000097707

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.7%
20x: 90.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aacs	T	A	5: 125,580,287 (GRCm39)	I204N	possibly damaging	Het
Acaca	A	G	11: 84,263,453 (GRCm39)	T2025A	probably damaging	Het
B4galt3	C	T	1: 171,103,938 (GRCm39)	R170C	probably benign	Het
BC028528	T	C	3: 95,799,271 (GRCm39)		probably null	Het
Ccdc73	A	T	2: 104,737,955 (GRCm39)	Q17L	possibly damaging	Het
Ccdc73	A	G	2: 104,745,012 (GRCm39)	T50A	possibly damaging	Het
Ccdc83	T	C	7: 89,908,677 (GRCm39)	D19G	probably damaging	Het
Ccn6	G	A	10: 39,029,239 (GRCm39)	R230W	probably damaging	Het
Cct8l1	T	C	5: 25,722,767 (GRCm39)	V494A	probably benign	Het
Chd1	T	C	17: 15,959,769 (GRCm39)	F663L	probably damaging	Het
Chn2	A	T	6: 54,270,065 (GRCm39)	E319V	probably damaging	Het
Cnnm1	T	C	19: 43,460,295 (GRCm39)	V679A	probably damaging	Het
Cntn6	C	T	6: 104,753,389 (GRCm39)	T447I	probably benign	Het
Cyp3a11	G	T	5: 145,795,581 (GRCm39)	L457I	probably benign	Het
Dera	T	A	6: 137,807,193 (GRCm39)	S214T	possibly damaging	Het
Dmtf1	A	G	5: 9,171,404 (GRCm39)	V501A	possibly damaging	Het
Dnpep	A	G	1: 75,292,671 (GRCm39)	V114A	probably damaging	Het
Dscam	C	T	16: 96,592,110 (GRCm39)	V722M	probably benign	Het
Dsp	A	G	13: 38,365,114 (GRCm39)	N499S	probably damaging	Het
Ecd	A	T	14: 20,396,725 (GRCm39)	Y53*	probably null	Het
Esyt3	T	C	9: 99,200,119 (GRCm39)	T692A	probably benign	Het
Fat1	T	A	8: 45,478,659 (GRCm39)	N2545K	probably damaging	Het
Fndc3a	A	G	14: 72,795,072 (GRCm39)		probably null	Het
Fscn3	A	G	6: 28,430,567 (GRCm39)	M246V	probably benign	Het
Gde1	G	T	7: 118,291,007 (GRCm39)	T106K	probably benign	Het
Gjc2	A	G	11: 59,068,434 (GRCm39)	I16T	possibly damaging	Het
Hacd4	A	T	4: 88,341,260 (GRCm39)	M168K	probably damaging	Het
Hmx3	A	G	7: 131,145,826 (GRCm39)	E178G	probably damaging	Het
Htt	A	G	5: 34,961,171 (GRCm39)	Y266C	probably damaging	Het
Jkampl	A	T	6: 73,446,039 (GRCm39)	L170Q	probably damaging	Het
Kif27	G	T	13: 58,451,359 (GRCm39)	R990S	probably damaging	Het
Krtap22-2	A	T	16: 88,807,534 (GRCm39)	Y21*	probably null	Het
Lrrc41	T	A	4: 115,952,405 (GRCm39)	L661*	probably null	Het
Lrrc63	T	C	14: 75,363,424 (GRCm39)	T236A	probably benign	Het
Mmp13	T	C	9: 7,272,892 (GRCm39)	L84P	probably damaging	Het
Myh8	T	C	11: 67,183,551 (GRCm39)	I754T	probably benign	Het
Neb	A	C	2: 52,065,619 (GRCm39)	D5961E	probably benign	Het
Nlrx1	T	C	9: 44,175,374 (GRCm39)	H134R	probably benign	Het
Npepps	A	T	11: 97,117,673 (GRCm39)	M542K	probably benign	Het
Nup160	C	T	2: 90,509,743 (GRCm39)		probably benign	Het
Or3a1c	T	A	11: 74,045,963 (GRCm39)		probably null	Het
Or8g33	T	A	9: 39,337,888 (GRCm39)	T160S	possibly damaging	Het
Ppp6r1	A	T	7: 4,643,377 (GRCm39)		probably null	Het
Prss33	A	G	17: 24,054,072 (GRCm39)	W45R	probably damaging	Het
Ptprf	A	T	4: 118,069,302 (GRCm39)	Y980*	probably null	Het
Qrich1	T	C	9: 108,436,531 (GRCm39)	V743A	probably benign	Het
Rev3l	G	A	10: 39,659,329 (GRCm39)		probably null	Het
Samd9l	A	T	6: 3,376,369 (GRCm39)	N297K	probably benign	Het
Sap130	A	G	18: 31,813,527 (GRCm39)	H528R	possibly damaging	Het
Slc9b2	T	C	3: 135,031,863 (GRCm39)	V241A	probably benign	Het
Snx14	A	T	9: 88,276,581 (GRCm39)	V577E	probably benign	Het
Srrm2	T	C	17: 24,034,876 (GRCm39)	S507P	probably benign	Het
Stat2	A	G	10: 128,117,969 (GRCm39)		probably null	Het
Susd5	T	C	9: 113,925,752 (GRCm39)	F545S	probably benign	Het
Tafa2	T	A	10: 123,429,401 (GRCm39)	M5K	possibly damaging	Het
Tnnt2	A	G	1: 135,775,764 (GRCm39)	T107A	probably benign	Het
Trappc6b	T	A	12: 59,094,953 (GRCm39)	I41F	possibly damaging	Het
Ttn	T	A	2: 76,682,417 (GRCm39)		probably benign	Het
Vmn1r88	A	C	7: 12,911,878 (GRCm39)	D78A	probably damaging	Het
Xpc	C	T	6: 91,485,510 (GRCm39)	D122N	possibly damaging	Het
Xpo1	C	T	11: 23,241,623 (GRCm39)	A890V	probably damaging	Het
Zfp493	A	G	13: 67,934,680 (GRCm39)	H211R	probably damaging	Het
Zfp958	A	T	8: 4,679,190 (GRCm39)	H405L	probably damaging	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65,299,280 (GRCm39)	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65,290,794 (GRCm39)	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65,298,028 (GRCm39)	nonsense	probably null
IGL01759:Pikfyve	APN	1	65,292,512 (GRCm39)	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65,262,799 (GRCm39)	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65,303,524 (GRCm39)	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65,277,703 (GRCm39)	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65,311,730 (GRCm39)	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65,285,556 (GRCm39)	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65,290,837 (GRCm39)	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65,295,180 (GRCm39)	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65,291,728 (GRCm39)	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65,283,663 (GRCm39)	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65,290,771 (GRCm39)	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65,303,535 (GRCm39)	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65,270,014 (GRCm39)	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65,273,431 (GRCm39)	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65,289,353 (GRCm39)	nonsense	probably null
IGL02890:Pikfyve	APN	1	65,269,956 (GRCm39)	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65,291,626 (GRCm39)	nonsense	probably null
IGL03294:Pikfyve	APN	1	65,286,226 (GRCm39)	missense	probably damaging	1.00
falcon	UTSW	1	65,235,900 (GRCm39)	missense	probably damaging	1.00
oompa	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
wonka	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65,242,075 (GRCm39)	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65,255,088 (GRCm39)	splice site	probably benign
R0196:Pikfyve	UTSW	1	65,295,231 (GRCm39)	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65,302,064 (GRCm39)	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65,285,490 (GRCm39)	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65,303,558 (GRCm39)	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65,259,058 (GRCm39)	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65,292,682 (GRCm39)	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65,292,556 (GRCm39)	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65,241,989 (GRCm39)	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65,304,983 (GRCm39)	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65,286,118 (GRCm39)	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65,241,989 (GRCm39)	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65,310,470 (GRCm39)	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65,290,825 (GRCm39)	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65,290,825 (GRCm39)	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65,263,360 (GRCm39)	missense	probably damaging	0.96
R1501:Pikfyve	UTSW	1	65,304,443 (GRCm39)	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65,291,707 (GRCm39)	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65,285,529 (GRCm39)	missense	probably benign
R1773:Pikfyve	UTSW	1	65,231,430 (GRCm39)	missense	probably damaging	0.99
R1795:Pikfyve	UTSW	1	65,291,716 (GRCm39)	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65,297,957 (GRCm39)	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65,231,454 (GRCm39)	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65,285,867 (GRCm39)	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65,261,516 (GRCm39)	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65,292,512 (GRCm39)	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65,307,014 (GRCm39)	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65,285,835 (GRCm39)	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65,292,676 (GRCm39)	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65,284,917 (GRCm39)	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65,283,579 (GRCm39)	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65,270,004 (GRCm39)	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65,235,840 (GRCm39)	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65,229,679 (GRCm39)	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65,283,589 (GRCm39)	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65,231,351 (GRCm39)	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65,273,421 (GRCm39)	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4716:Pikfyve	UTSW	1	65,285,635 (GRCm39)	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65,311,674 (GRCm39)	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4785:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4805:Pikfyve	UTSW	1	65,307,959 (GRCm39)	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65,235,900 (GRCm39)	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65,285,749 (GRCm39)	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65,292,566 (GRCm39)	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65,263,276 (GRCm39)	intron	probably benign
R5265:Pikfyve	UTSW	1	65,306,988 (GRCm39)	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65,235,858 (GRCm39)	nonsense	probably null
R5384:Pikfyve	UTSW	1	65,283,568 (GRCm39)	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65,304,427 (GRCm39)	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65,274,192 (GRCm39)	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65,291,654 (GRCm39)	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65,292,566 (GRCm39)	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65,312,889 (GRCm39)	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65,295,247 (GRCm39)	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65,255,187 (GRCm39)	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65,241,896 (GRCm39)	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65,292,597 (GRCm39)	nonsense	probably null
R6026:Pikfyve	UTSW	1	65,311,856 (GRCm39)	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65,311,730 (GRCm39)	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65,303,504 (GRCm39)	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65,303,504 (GRCm39)	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65,255,202 (GRCm39)	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65,292,691 (GRCm39)	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65,242,084 (GRCm39)	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65,302,112 (GRCm39)	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65,304,940 (GRCm39)	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65,298,002 (GRCm39)	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65,291,689 (GRCm39)	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65,285,822 (GRCm39)	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65,273,520 (GRCm39)	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65,286,013 (GRCm39)	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65,286,364 (GRCm39)	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65,283,585 (GRCm39)	nonsense	probably null
R7558:Pikfyve	UTSW	1	65,311,782 (GRCm39)	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65,307,036 (GRCm39)	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65,309,101 (GRCm39)	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65,294,293 (GRCm39)	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65,294,293 (GRCm39)	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65,304,948 (GRCm39)	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65,285,554 (GRCm39)	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65,292,501 (GRCm39)	splice site	probably benign
R8307:Pikfyve	UTSW	1	65,284,894 (GRCm39)	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65,255,155 (GRCm39)	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65,283,576 (GRCm39)	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65,310,427 (GRCm39)	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65,286,129 (GRCm39)	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65,244,746 (GRCm39)	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65,283,559 (GRCm39)	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65,285,239 (GRCm39)	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65,235,898 (GRCm39)	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65,291,719 (GRCm39)	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65,291,719 (GRCm39)	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65,299,188 (GRCm39)	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65,307,901 (GRCm39)	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65,303,561 (GRCm39)	missense	probably benign
R9605:Pikfyve	UTSW	1	65,303,561 (GRCm39)	missense	probably benign
R9686:Pikfyve	UTSW	1	65,291,615 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGAGGCATTCTCTGAGGGTTAGAAAA -3'
(R):5'- GCCATGCATCATCCCATTGTTAAAGC -3'

Sequencing Primer
(F):5'- ataaaagtgacagacagtgacaag -3'
(R):5'- GGTTTCTATCTAAAGAGCCCCAA -3'

Posted On

2014-03-28