Incidental Mutation 'R1478:B4galt3'
ID165597
Institutional Source Beutler Lab
Gene Symbol B4galt3
Ensembl Gene ENSMUSG00000052423
Gene NameUDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3
Synonyms9530061M23Rik, R74981, ESTM26, beta4GalT-III
MMRRC Submission 039531-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R1478 (G1)
Quality Score133
Status Not validated
Chromosome1
Chromosomal Location171270328-171276896 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 171276365 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 170 (R170C)
Ref Sequence ENSEMBL: ENSMUSP00000141958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064272] [ENSMUST00000073120] [ENSMUST00000111313] [ENSMUST00000126699] [ENSMUST00000141114] [ENSMUST00000141999] [ENSMUST00000151863] [ENSMUST00000192956]
Predicted Effect probably benign
Transcript: ENSMUST00000064272
AA Change: R392C

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000066353
Gene: ENSMUSG00000052423
AA Change: R392C

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 212 1.7e-59 PFAM
Pfam:Glyco_transf_7C 217 294 6.3e-32 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073120
SMART Domains Protein: ENSMUSP00000072863
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 74 1.3e-9 PFAM
Pfam:Amino_oxidase 12 471 1.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111313
AA Change: R392C

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106945
Gene: ENSMUSG00000052423
AA Change: R392C

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 214 2.1e-74 PFAM
Pfam:Glyco_transf_7C 217 294 1.7e-31 PFAM
Pfam:Glyco_tranf_2_2 238 298 1e-6 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125939
Predicted Effect probably benign
Transcript: ENSMUST00000126699
AA Change: R170C

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141958
Gene: ENSMUSG00000052423
AA Change: R170C

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 1 72 3.2e-28 PFAM
Pfam:Glyco_tranf_2_2 16 76 2.1e-5 PFAM
low complexity region 126 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133050
Predicted Effect probably benign
Transcript: ENSMUST00000141114
SMART Domains Protein: ENSMUSP00000114560
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:Glyco_transf_7N 104 139 2.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141999
SMART Domains Protein: ENSMUSP00000114926
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151442
Predicted Effect probably benign
Transcript: ENSMUST00000151863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155083
Predicted Effect probably benign
Transcript: ENSMUST00000192956
SMART Domains Protein: ENSMUSP00000141835
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 72 1.6e-7 PFAM
Pfam:Amino_oxidase 12 389 4.7e-29 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,056 L170Q probably damaging Het
Aacs T A 5: 125,503,223 I204N possibly damaging Het
Acaca A G 11: 84,372,627 T2025A probably damaging Het
BC028528 T C 3: 95,891,959 probably null Het
Ccdc73 A T 2: 104,907,610 Q17L possibly damaging Het
Ccdc73 A G 2: 104,914,667 T50A possibly damaging Het
Ccdc83 T C 7: 90,259,469 D19G probably damaging Het
Cct8l1 T C 5: 25,517,769 V494A probably benign Het
Chd1 T C 17: 15,739,507 F663L probably damaging Het
Chn2 A T 6: 54,293,080 E319V probably damaging Het
Cnnm1 T C 19: 43,471,856 V679A probably damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Cyp3a11 G T 5: 145,858,771 L457I probably benign Het
Dera T A 6: 137,830,195 S214T possibly damaging Het
Dmtf1 A G 5: 9,121,404 V501A possibly damaging Het
Dnpep A G 1: 75,316,027 V114A probably damaging Het
Dscam C T 16: 96,790,910 V722M probably benign Het
Dsp A G 13: 38,181,138 N499S probably damaging Het
Ecd A T 14: 20,346,657 Y53* probably null Het
Esyt3 T C 9: 99,318,066 T692A probably benign Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fat1 T A 8: 45,025,622 N2545K probably damaging Het
Fndc3a A G 14: 72,557,632 probably null Het
Fscn3 A G 6: 28,430,568 M246V probably benign Het
Gde1 G T 7: 118,691,784 T106K probably benign Het
Gjc2 A G 11: 59,177,608 I16T possibly damaging Het
Hacd4 A T 4: 88,423,023 M168K probably damaging Het
Hmx3 A G 7: 131,544,097 E178G probably damaging Het
Htt A G 5: 34,803,827 Y266C probably damaging Het
Kif27 G T 13: 58,303,545 R990S probably damaging Het
Krtap22-2 A T 16: 89,010,646 Y21* probably null Het
Lrrc41 T A 4: 116,095,208 L661* probably null Het
Lrrc63 T C 14: 75,125,984 T236A probably benign Het
Mmp13 T C 9: 7,272,892 L84P probably damaging Het
Myh8 T C 11: 67,292,725 I754T probably benign Het
Neb A C 2: 52,175,607 D5961E probably benign Het
Nlrx1 T C 9: 44,264,077 H134R probably benign Het
Npepps A T 11: 97,226,847 M542K probably benign Het
Nup160 C T 2: 90,679,399 probably benign Het
Olfr402 T A 11: 74,155,137 probably null Het
Olfr952 T A 9: 39,426,592 T160S possibly damaging Het
Pikfyve T C 1: 65,262,977 probably null Het
Ppp6r1 A T 7: 4,640,378 probably null Het
Prss33 A G 17: 23,835,098 W45R probably damaging Het
Ptprf A T 4: 118,212,105 Y980* probably null Het
Qrich1 T C 9: 108,559,332 V743A probably benign Het
Rev3l G A 10: 39,783,333 probably null Het
Samd9l A T 6: 3,376,369 N297K probably benign Het
Sap130 A G 18: 31,680,474 H528R possibly damaging Het
Slc9b2 T C 3: 135,326,102 V241A probably benign Het
Snx14 A T 9: 88,394,528 V577E probably benign Het
Srrm2 T C 17: 23,815,902 S507P probably benign Het
Stat2 A G 10: 128,282,100 probably null Het
Susd5 T C 9: 114,096,684 F545S probably benign Het
Tnnt2 A G 1: 135,848,026 T107A probably benign Het
Trappc6b T A 12: 59,048,167 I41F possibly damaging Het
Ttn T A 2: 76,852,073 probably benign Het
Vmn1r88 A C 7: 13,177,951 D78A probably damaging Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Xpc C T 6: 91,508,528 D122N possibly damaging Het
Xpo1 C T 11: 23,291,623 A890V probably damaging Het
Zfp493 A G 13: 67,786,561 H211R probably damaging Het
Zfp958 A T 8: 4,629,190 H405L probably damaging Het
Other mutations in B4galt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:B4galt3 APN 1 171271792 missense probably damaging 1.00
R0026:B4galt3 UTSW 1 171274261 unclassified probably benign
R0126:B4galt3 UTSW 1 171276165 missense probably damaging 0.97
R0537:B4galt3 UTSW 1 171274251 unclassified probably benign
R2012:B4galt3 UTSW 1 171272548 missense probably damaging 1.00
R2206:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2207:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2223:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2353:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2354:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2438:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2439:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3039:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3051:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3709:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3710:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3741:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3742:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3813:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3953:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4058:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4059:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4323:B4galt3 UTSW 1 171275942 missense possibly damaging 0.93
R4367:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4368:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4370:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4371:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4486:B4galt3 UTSW 1 171271773 missense possibly damaging 0.94
R4538:B4galt3 UTSW 1 171272710 missense probably damaging 1.00
R5557:B4galt3 UTSW 1 171272519 critical splice acceptor site probably null
R7313:B4galt3 UTSW 1 171272749 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTCACTAACGTACCGACTGCTG -3'
(R):5'- ATTCACAGAGGTCCCAGGAGAAGC -3'

Sequencing Primer
(F):5'- GAGAGCTGGGTCCTCTCTATAC -3'
(R):5'- CAGTCATAAGCCCTGACAGGTG -3'
Posted On2014-03-28