Incidental Mutation 'R1478:Samd9l'
ID165615
Institutional Source Beutler Lab
Gene Symbol Samd9l
Ensembl Gene ENSMUSG00000047735
Gene Namesterile alpha motif domain containing 9-like
SynonymsESTM25
MMRRC Submission 039531-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1478 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location3372257-3399572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3376369 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 297 (N297K)
Ref Sequence ENSEMBL: ENSMUSP00000112688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]
Predicted Effect probably benign
Transcript: ENSMUST00000120087
AA Change: N297K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: N297K

DomainStartEndE-ValueType
SCOP:d1kw4a_ 8 75 4e-8 SMART
Blast:SAM 11 75 1e-30 BLAST
low complexity region 96 115 N/A INTRINSIC
low complexity region 385 397 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201638
SMART Domains Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

DomainStartEndE-ValueType
Pfam:Ste50p-SAM 10 80 1.2e-8 PFAM
Pfam:SAM_2 11 68 8.7e-6 PFAM
Pfam:SAM_1 12 71 2.5e-7 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,056 L170Q probably damaging Het
Aacs T A 5: 125,503,223 I204N possibly damaging Het
Acaca A G 11: 84,372,627 T2025A probably damaging Het
B4galt3 C T 1: 171,276,365 R170C probably benign Het
BC028528 T C 3: 95,891,959 probably null Het
Ccdc73 A T 2: 104,907,610 Q17L possibly damaging Het
Ccdc73 A G 2: 104,914,667 T50A possibly damaging Het
Ccdc83 T C 7: 90,259,469 D19G probably damaging Het
Cct8l1 T C 5: 25,517,769 V494A probably benign Het
Chd1 T C 17: 15,739,507 F663L probably damaging Het
Chn2 A T 6: 54,293,080 E319V probably damaging Het
Cnnm1 T C 19: 43,471,856 V679A probably damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Cyp3a11 G T 5: 145,858,771 L457I probably benign Het
Dera T A 6: 137,830,195 S214T possibly damaging Het
Dmtf1 A G 5: 9,121,404 V501A possibly damaging Het
Dnpep A G 1: 75,316,027 V114A probably damaging Het
Dscam C T 16: 96,790,910 V722M probably benign Het
Dsp A G 13: 38,181,138 N499S probably damaging Het
Ecd A T 14: 20,346,657 Y53* probably null Het
Esyt3 T C 9: 99,318,066 T692A probably benign Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fat1 T A 8: 45,025,622 N2545K probably damaging Het
Fndc3a A G 14: 72,557,632 probably null Het
Fscn3 A G 6: 28,430,568 M246V probably benign Het
Gde1 G T 7: 118,691,784 T106K probably benign Het
Gjc2 A G 11: 59,177,608 I16T possibly damaging Het
Hacd4 A T 4: 88,423,023 M168K probably damaging Het
Hmx3 A G 7: 131,544,097 E178G probably damaging Het
Htt A G 5: 34,803,827 Y266C probably damaging Het
Kif27 G T 13: 58,303,545 R990S probably damaging Het
Krtap22-2 A T 16: 89,010,646 Y21* probably null Het
Lrrc41 T A 4: 116,095,208 L661* probably null Het
Lrrc63 T C 14: 75,125,984 T236A probably benign Het
Mmp13 T C 9: 7,272,892 L84P probably damaging Het
Myh8 T C 11: 67,292,725 I754T probably benign Het
Neb A C 2: 52,175,607 D5961E probably benign Het
Nlrx1 T C 9: 44,264,077 H134R probably benign Het
Npepps A T 11: 97,226,847 M542K probably benign Het
Nup160 C T 2: 90,679,399 probably benign Het
Olfr402 T A 11: 74,155,137 probably null Het
Olfr952 T A 9: 39,426,592 T160S possibly damaging Het
Pikfyve T C 1: 65,262,977 probably null Het
Ppp6r1 A T 7: 4,640,378 probably null Het
Prss33 A G 17: 23,835,098 W45R probably damaging Het
Ptprf A T 4: 118,212,105 Y980* probably null Het
Qrich1 T C 9: 108,559,332 V743A probably benign Het
Rev3l G A 10: 39,783,333 probably null Het
Sap130 A G 18: 31,680,474 H528R possibly damaging Het
Slc9b2 T C 3: 135,326,102 V241A probably benign Het
Snx14 A T 9: 88,394,528 V577E probably benign Het
Srrm2 T C 17: 23,815,902 S507P probably benign Het
Stat2 A G 10: 128,282,100 probably null Het
Susd5 T C 9: 114,096,684 F545S probably benign Het
Tnnt2 A G 1: 135,848,026 T107A probably benign Het
Trappc6b T A 12: 59,048,167 I41F possibly damaging Het
Ttn T A 2: 76,852,073 probably benign Het
Vmn1r88 A C 7: 13,177,951 D78A probably damaging Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Xpc C T 6: 91,508,528 D122N possibly damaging Het
Xpo1 C T 11: 23,291,623 A890V probably damaging Het
Zfp493 A G 13: 67,786,561 H211R probably damaging Het
Zfp958 A T 8: 4,629,190 H405L probably damaging Het
Other mutations in Samd9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Samd9l APN 6 3376779 missense probably damaging 0.96
IGL00550:Samd9l APN 6 3374594 missense probably benign 0.00
IGL01100:Samd9l APN 6 3375863 missense possibly damaging 0.91
IGL01321:Samd9l APN 6 3376259 missense probably benign 0.42
IGL01553:Samd9l APN 6 3375566 missense probably damaging 0.99
IGL01575:Samd9l APN 6 3376734 missense possibly damaging 0.85
IGL01896:Samd9l APN 6 3375120 missense probably benign 0.02
IGL01915:Samd9l APN 6 3373864 nonsense probably null
IGL02063:Samd9l APN 6 3372992 missense probably damaging 1.00
IGL02066:Samd9l APN 6 3376575 missense probably damaging 1.00
IGL02145:Samd9l APN 6 3374105 missense probably benign 0.13
IGL02163:Samd9l APN 6 3374246 missense possibly damaging 0.90
IGL02256:Samd9l APN 6 3376197 missense probably damaging 1.00
IGL02508:Samd9l APN 6 3374798 missense probably damaging 1.00
IGL02591:Samd9l APN 6 3375760 missense possibly damaging 0.91
IGL02968:Samd9l APN 6 3376026 missense probably damaging 1.00
IGL03058:Samd9l APN 6 3374980 missense probably damaging 0.99
IGL03068:Samd9l APN 6 3375348 nonsense probably null
IGL03160:Samd9l APN 6 3374894 missense probably damaging 1.00
IGL03372:Samd9l APN 6 3375314 missense probably damaging 1.00
IGL03385:Samd9l APN 6 3376208 missense probably damaging 0.99
boston_lager UTSW 6 3375761 missense probably benign 0.12
ipa UTSW 6 3376347 missense probably damaging 1.00
IGL03054:Samd9l UTSW 6 3376023 missense probably damaging 1.00
R0111:Samd9l UTSW 6 3374946 missense possibly damaging 0.80
R0112:Samd9l UTSW 6 3376031 missense possibly damaging 0.93
R0356:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R0370:Samd9l UTSW 6 3377264 start gained probably benign
R0398:Samd9l UTSW 6 3374502 missense probably damaging 1.00
R0744:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0833:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0880:Samd9l UTSW 6 3377064 missense probably damaging 1.00
R1110:Samd9l UTSW 6 3374267 missense probably benign 0.44
R1155:Samd9l UTSW 6 3376939 missense probably benign 0.01
R1268:Samd9l UTSW 6 3376113 missense possibly damaging 0.56
R1293:Samd9l UTSW 6 3373947 missense possibly damaging 0.93
R1573:Samd9l UTSW 6 3375426 missense probably damaging 0.99
R1590:Samd9l UTSW 6 3375761 missense probably benign 0.12
R1611:Samd9l UTSW 6 3373771 missense probably benign 0.00
R1754:Samd9l UTSW 6 3373126 missense probably damaging 0.96
R1759:Samd9l UTSW 6 3373401 missense probably damaging 1.00
R1795:Samd9l UTSW 6 3375264 nonsense probably null
R1829:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R1935:Samd9l UTSW 6 3376269 missense probably benign 0.01
R2154:Samd9l UTSW 6 3372945 missense possibly damaging 0.91
R2228:Samd9l UTSW 6 3376910 missense probably benign 0.08
R3622:Samd9l UTSW 6 3374032 nonsense probably null
R3903:Samd9l UTSW 6 3376830 nonsense probably null
R3904:Samd9l UTSW 6 3376830 nonsense probably null
R3945:Samd9l UTSW 6 3377029 missense possibly damaging 0.71
R4091:Samd9l UTSW 6 3376887 missense probably benign 0.22
R4602:Samd9l UTSW 6 3373935 missense probably damaging 1.00
R4602:Samd9l UTSW 6 3373937 frame shift probably null
R4618:Samd9l UTSW 6 3376347 missense probably damaging 1.00
R4747:Samd9l UTSW 6 3375504 nonsense probably null
R4762:Samd9l UTSW 6 3375623 missense probably benign 0.01
R4814:Samd9l UTSW 6 3372863 missense probably damaging 0.98
R4934:Samd9l UTSW 6 3375621 nonsense probably null
R5026:Samd9l UTSW 6 3375284 missense possibly damaging 0.75
R5048:Samd9l UTSW 6 3374157 missense probably benign 0.35
R5130:Samd9l UTSW 6 3374548 missense possibly damaging 0.69
R5271:Samd9l UTSW 6 3376156 missense probably benign 0.02
R5328:Samd9l UTSW 6 3376739 missense probably damaging 0.99
R5507:Samd9l UTSW 6 3373898 missense possibly damaging 0.78
R5587:Samd9l UTSW 6 3373291 missense possibly damaging 0.84
R5846:Samd9l UTSW 6 3376754 missense probably benign
R5881:Samd9l UTSW 6 3372716 missense possibly damaging 0.70
R5889:Samd9l UTSW 6 3376460 missense probably damaging 1.00
R6131:Samd9l UTSW 6 3377252 missense probably benign 0.00
R6199:Samd9l UTSW 6 3376686 missense probably benign 0.13
R6298:Samd9l UTSW 6 3375383 missense probably damaging 1.00
R6331:Samd9l UTSW 6 3376361 missense probably damaging 1.00
R6489:Samd9l UTSW 6 3376896 missense probably benign
R6601:Samd9l UTSW 6 3377229 missense possibly damaging 0.74
R6655:Samd9l UTSW 6 3377247 missense probably benign 0.22
R6803:Samd9l UTSW 6 3375446 missense probably damaging 0.97
R6864:Samd9l UTSW 6 3374750 missense probably benign 0.14
R6905:Samd9l UTSW 6 3375387 missense probably damaging 0.99
R6919:Samd9l UTSW 6 3376313 missense possibly damaging 0.88
R7060:Samd9l UTSW 6 3372716 missense probably damaging 0.99
R7073:Samd9l UTSW 6 3375856 nonsense probably null
R7250:Samd9l UTSW 6 3374201 missense possibly damaging 0.78
R7307:Samd9l UTSW 6 3372600 nonsense probably null
R7351:Samd9l UTSW 6 3374157 missense probably benign 0.35
R7423:Samd9l UTSW 6 3374408 missense probably damaging 1.00
R7610:Samd9l UTSW 6 3376754 missense probably benign
R7667:Samd9l UTSW 6 3375975 missense possibly damaging 0.87
R7672:Samd9l UTSW 6 3373646 missense probably benign 0.16
R7680:Samd9l UTSW 6 3372569 missense probably damaging 1.00
R7680:Samd9l UTSW 6 3376469 missense probably damaging 1.00
R7814:Samd9l UTSW 6 3374793 missense possibly damaging 0.86
R7829:Samd9l UTSW 6 3374749 missense probably benign 0.00
R8000:Samd9l UTSW 6 3373034 missense probably damaging 1.00
R8098:Samd9l UTSW 6 3375549 missense probably damaging 1.00
X0026:Samd9l UTSW 6 3375560 missense probably damaging 1.00
X0066:Samd9l UTSW 6 3374477 missense probably damaging 1.00
Z1176:Samd9l UTSW 6 3376770 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTGACCACTCCCTTGATGTGAG -3'
(R):5'- GACAAACCACACGGGGAAATTGTTG -3'

Sequencing Primer
(F):5'- CCACTCCCTTGATGTGAGAATAAG -3'
(R):5'- TGGTGTGCAAGTCACCAG -3'
Posted On2014-03-28