Incidental Mutation 'R1478:Wisp3'
ID165638
Institutional Source Beutler Lab
Gene Symbol Wisp3
Ensembl Gene ENSMUSG00000062074
Gene NameWNT1 inducible signaling pathway protein 3
SynonymsLOC327743, CCN6
MMRRC Submission 039531-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1478 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location39150970-39163794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39153243 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 230 (R230W)
Ref Sequence ENSEMBL: ENSMUSP00000076003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019991] [ENSMUST00000076713] [ENSMUST00000213459]
Predicted Effect probably benign
Transcript: ENSMUST00000019991
SMART Domains Protein: ENSMUSP00000019991
Gene: ENSMUSG00000019845

DomainStartEndE-ValueType
Tubulin 55 277 1.08e-38 SMART
Tubulin_C 279 414 9.81e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076713
AA Change: R230W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076003
Gene: ENSMUSG00000062074
AA Change: R230W

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IB 46 116 1.01e-15 SMART
Blast:VWC 122 179 1e-27 BLAST
TSP1 211 253 6.58e-5 SMART
CT 273 342 1.23e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214493
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene is overexpressed in colon tumors. It may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Mutations of this gene are associated with progressive pseudorheumatoid dysplasia, an autosomal recessive skeletal disorder, indicating that the gene is essential for normal postnatal skeletal growth and cartilage homeostasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with no obvious abnormalities in size, weight, skeletal development, ossification, or the occurrence of joint disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,056 L170Q probably damaging Het
Aacs T A 5: 125,503,223 I204N possibly damaging Het
Acaca A G 11: 84,372,627 T2025A probably damaging Het
B4galt3 C T 1: 171,276,365 R170C probably benign Het
BC028528 T C 3: 95,891,959 probably null Het
Ccdc73 A T 2: 104,907,610 Q17L possibly damaging Het
Ccdc73 A G 2: 104,914,667 T50A possibly damaging Het
Ccdc83 T C 7: 90,259,469 D19G probably damaging Het
Cct8l1 T C 5: 25,517,769 V494A probably benign Het
Chd1 T C 17: 15,739,507 F663L probably damaging Het
Chn2 A T 6: 54,293,080 E319V probably damaging Het
Cnnm1 T C 19: 43,471,856 V679A probably damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Cyp3a11 G T 5: 145,858,771 L457I probably benign Het
Dera T A 6: 137,830,195 S214T possibly damaging Het
Dmtf1 A G 5: 9,121,404 V501A possibly damaging Het
Dnpep A G 1: 75,316,027 V114A probably damaging Het
Dscam C T 16: 96,790,910 V722M probably benign Het
Dsp A G 13: 38,181,138 N499S probably damaging Het
Ecd A T 14: 20,346,657 Y53* probably null Het
Esyt3 T C 9: 99,318,066 T692A probably benign Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fat1 T A 8: 45,025,622 N2545K probably damaging Het
Fndc3a A G 14: 72,557,632 probably null Het
Fscn3 A G 6: 28,430,568 M246V probably benign Het
Gde1 G T 7: 118,691,784 T106K probably benign Het
Gjc2 A G 11: 59,177,608 I16T possibly damaging Het
Hacd4 A T 4: 88,423,023 M168K probably damaging Het
Hmx3 A G 7: 131,544,097 E178G probably damaging Het
Htt A G 5: 34,803,827 Y266C probably damaging Het
Kif27 G T 13: 58,303,545 R990S probably damaging Het
Krtap22-2 A T 16: 89,010,646 Y21* probably null Het
Lrrc41 T A 4: 116,095,208 L661* probably null Het
Lrrc63 T C 14: 75,125,984 T236A probably benign Het
Mmp13 T C 9: 7,272,892 L84P probably damaging Het
Myh8 T C 11: 67,292,725 I754T probably benign Het
Neb A C 2: 52,175,607 D5961E probably benign Het
Nlrx1 T C 9: 44,264,077 H134R probably benign Het
Npepps A T 11: 97,226,847 M542K probably benign Het
Nup160 C T 2: 90,679,399 probably benign Het
Olfr402 T A 11: 74,155,137 probably null Het
Olfr952 T A 9: 39,426,592 T160S possibly damaging Het
Pikfyve T C 1: 65,262,977 probably null Het
Ppp6r1 A T 7: 4,640,378 probably null Het
Prss33 A G 17: 23,835,098 W45R probably damaging Het
Ptprf A T 4: 118,212,105 Y980* probably null Het
Qrich1 T C 9: 108,559,332 V743A probably benign Het
Rev3l G A 10: 39,783,333 probably null Het
Samd9l A T 6: 3,376,369 N297K probably benign Het
Sap130 A G 18: 31,680,474 H528R possibly damaging Het
Slc9b2 T C 3: 135,326,102 V241A probably benign Het
Snx14 A T 9: 88,394,528 V577E probably benign Het
Srrm2 T C 17: 23,815,902 S507P probably benign Het
Stat2 A G 10: 128,282,100 probably null Het
Susd5 T C 9: 114,096,684 F545S probably benign Het
Tnnt2 A G 1: 135,848,026 T107A probably benign Het
Trappc6b T A 12: 59,048,167 I41F possibly damaging Het
Ttn T A 2: 76,852,073 probably benign Het
Vmn1r88 A C 7: 13,177,951 D78A probably damaging Het
Xpc C T 6: 91,508,528 D122N possibly damaging Het
Xpo1 C T 11: 23,291,623 A890V probably damaging Het
Zfp493 A G 13: 67,786,561 H211R probably damaging Het
Zfp958 A T 8: 4,629,190 H405L probably damaging Het
Other mutations in Wisp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Wisp3 APN 10 39158310 missense probably damaging 1.00
IGL02429:Wisp3 APN 10 39154993 missense probably benign 0.03
IGL02675:Wisp3 APN 10 39151240 missense possibly damaging 0.77
IGL03160:Wisp3 APN 10 39153237 missense probably damaging 1.00
IGL03214:Wisp3 APN 10 39153167 missense probably benign 0.04
R0666:Wisp3 UTSW 10 39151289 missense probably benign 0.45
R1350:Wisp3 UTSW 10 39158306 missense probably damaging 1.00
R1479:Wisp3 UTSW 10 39153243 missense probably damaging 1.00
R1624:Wisp3 UTSW 10 39153243 missense probably damaging 1.00
R3833:Wisp3 UTSW 10 39154949 missense probably benign 0.00
R3975:Wisp3 UTSW 10 39155098 missense probably damaging 1.00
R5051:Wisp3 UTSW 10 39155156 missense probably benign 0.00
R6000:Wisp3 UTSW 10 39158300 missense probably damaging 1.00
R6492:Wisp3 UTSW 10 39154987 missense probably benign 0.01
R6775:Wisp3 UTSW 10 39151355 missense probably damaging 0.99
R7053:Wisp3 UTSW 10 39158301 missense probably damaging 1.00
R7138:Wisp3 UTSW 10 39158477 missense possibly damaging 0.80
R7253:Wisp3 UTSW 10 39155035 missense probably benign 0.04
R7367:Wisp3 UTSW 10 39158265 missense probably damaging 1.00
R7475:Wisp3 UTSW 10 39158300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCGCCCTCTGAGATAATTCAC -3'
(R):5'- ACAAGGCCACACTTGACTGGAAG -3'

Sequencing Primer
(F):5'- TTGATGAGATCCGAGTATAACCCC -3'
(R):5'- TCCTTTCACGTAAAAAGCCTGAG -3'
Posted On2014-03-28