Incidental Mutation 'R1483:Ecm1'
ID165679
Institutional Source Beutler Lab
Gene Symbol Ecm1
Ensembl Gene ENSMUSG00000028108
Gene Nameextracellular matrix protein 1
Synonymsp85
MMRRC Submission 039536-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R1483 (G1)
Quality Score192
Status Not validated
Chromosome3
Chromosomal Location95734147-95739569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95735963 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 342 (R342C)
Ref Sequence ENSEMBL: ENSMUSP00000112665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029752] [ENSMUST00000029753] [ENSMUST00000074339] [ENSMUST00000117507] [ENSMUST00000123143] [ENSMUST00000128885] [ENSMUST00000131376] [ENSMUST00000137912] [ENSMUST00000147217] [ENSMUST00000153026] [ENSMUST00000163530] [ENSMUST00000196077] [ENSMUST00000199464]
Predicted Effect probably benign
Transcript: ENSMUST00000029752
SMART Domains Protein: ENSMUSP00000029752
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 5.6e-14 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 400 608 2.4e-32 PFAM
Pfam:HGTP_anticodon 620 711 1.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000029753
AA Change: R341C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029753
Gene: ENSMUSG00000028108
AA Change: R341C

DomainStartEndE-ValueType
Pfam:ECM1 1 558 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074339
SMART Domains Protein: ENSMUSP00000073946
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.3e-15 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 336 519 2.8e-39 PFAM
Pfam:HGTP_anticodon 594 685 5.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117507
AA Change: R342C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112665
Gene: ENSMUSG00000028108
AA Change: R342C

DomainStartEndE-ValueType
Pfam:ECM1 1 559 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123143
SMART Domains Protein: ENSMUSP00000120300
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 266 4.4e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128885
SMART Domains Protein: ENSMUSP00000120820
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 251 1.5e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131376
SMART Domains Protein: ENSMUSP00000114659
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 295 4.2e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137912
SMART Domains Protein: ENSMUSP00000122243
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 140 1.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144958
Predicted Effect probably benign
Transcript: ENSMUST00000147217
SMART Domains Protein: ENSMUSP00000115524
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 80 5.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153026
SMART Domains Protein: ENSMUSP00000114747
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 230 1.3e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200376
Predicted Effect probably benign
Transcript: ENSMUST00000163530
SMART Domains Protein: ENSMUSP00000130269
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 2.6e-15 PFAM
tRNA_SAD 152 201 1.15e-10 SMART
Pfam:tRNA-synt_2b 255 438 8.6e-40 PFAM
Pfam:HGTP_anticodon 539 630 1.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196077
SMART Domains Protein: ENSMUSP00000143722
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 65 125 5e-13 PFAM
tRNA_SAD 232 264 7.5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199464
SMART Domains Protein: ENSMUSP00000143328
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.1e-13 PFAM
Meta Mutation Damage Score 0.2379 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a soluble protein that is involved in endochondral bone formation, angiogenesis, and tumor biology. It also interacts with a variety of extracellular and structural proteins, contributing to the maintenance of skin integrity and homeostasis. Mutations in this gene are associated with lipoid proteinosis disorder (also known as hyalinosis cutis et mucosae or Urbach-Wiethe disease) that is characterized by generalized thickening of skin, mucosae and certain viscera. Alternatively spliced transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit auto-inflammatory disease and do not survive beyond 6 to 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,903 S368T probably damaging Het
9930021J03Rik G A 19: 29,719,345 P916L possibly damaging Het
Adam12 T A 7: 133,930,025 T494S probably benign Het
Akap6 C T 12: 52,796,087 P73S probably damaging Het
Amotl2 A T 9: 102,730,897 T763S probably benign Het
C87499 T A 4: 88,628,834 Q116L probably damaging Het
Cdc5l A T 17: 45,408,364 V541D possibly damaging Het
Chl1 A G 6: 103,647,287 Y52C probably damaging Het
D6Wsu163e A G 6: 126,954,770 E255G probably benign Het
Ddhd2 A G 8: 25,753,128 S126P probably benign Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Drc3 A G 11: 60,388,889 I427V probably benign Het
Drg2 T C 11: 60,459,527 I104T probably damaging Het
Dst C T 1: 34,252,998 A932V probably damaging Het
Eif3a A T 19: 60,768,726 D880E unknown Het
Elf1 T A 14: 79,580,638 D569E probably benign Het
Esp6 T A 17: 40,562,925 M1K probably null Het
Fer1l6 T C 15: 58,637,970 V1427A possibly damaging Het
Gm17689 G A 9: 36,581,324 S95L probably benign Het
Gsta1 A T 9: 78,242,493 K196M probably damaging Het
Gzme T A 14: 56,118,712 I110F probably damaging Het
H2-DMa T A 17: 34,135,750 V27E possibly damaging Het
H2-T10 A T 17: 36,121,146 S2T probably benign Het
Hadhb A G 5: 30,169,494 probably null Het
Hoxa11 G T 6: 52,243,456 D282E probably damaging Het
Ifit1bl1 A G 19: 34,594,641 Y139H possibly damaging Het
Ift27 A G 15: 78,165,236 V88A possibly damaging Het
Knop1 C T 7: 118,853,050 A149T probably damaging Het
Macf1 T A 4: 123,510,977 K597I probably damaging Het
Med16 A T 10: 79,903,100 I284N possibly damaging Het
Melk T A 4: 44,308,937 I98K probably damaging Het
Mst1 G T 9: 108,081,650 G127V probably benign Het
Nacad A G 11: 6,602,217 S325P probably damaging Het
Nbea G A 3: 56,002,790 P1328L probably benign Het
Nek5 C T 8: 22,096,790 S335N probably benign Het
Nif3l1 C A 1: 58,447,726 R24S probably benign Het
Nlrp14 T G 7: 107,190,122 N39K possibly damaging Het
Nup50 T A 15: 84,939,727 V427D probably damaging Het
Nwd1 C T 8: 72,657,086 P78L probably damaging Het
Olfr1431 T A 19: 12,209,750 Y61* probably null Het
Pnkd A G 1: 74,349,391 Y242C probably benign Het
Ppm1g T C 5: 31,203,121 D423G probably benign Het
Prkci A T 3: 31,043,792 N464Y probably damaging Het
Ptprf C T 4: 118,235,964 V494M possibly damaging Het
Rapgef4 T G 2: 72,055,026 probably null Het
Rbak T C 5: 143,174,344 E318G probably damaging Het
Rora A G 9: 69,364,385 D215G probably benign Het
Rp1l1 C T 14: 64,029,047 T694I possibly damaging Het
Scrib A G 15: 76,057,922 L1032P probably damaging Het
Sectm1b G A 11: 121,055,826 T81M probably benign Het
Sgk3 T C 1: 9,872,293 F97L possibly damaging Het
Socs3 A T 11: 117,967,568 Y221* probably null Het
Tdrd6 T A 17: 43,627,607 H850L probably benign Het
Tex44 G T 1: 86,427,186 Q272H probably damaging Het
Tgfbr2 A C 9: 116,109,557 S426A probably benign Het
Tmem39b T C 4: 129,676,663 Y461C probably damaging Het
Ttn T A 2: 76,724,993 D30556V probably damaging Het
Tubgcp5 T A 7: 55,825,707 probably null Het
Vmn2r70 T C 7: 85,559,167 I701V probably benign Het
Vps39 A T 2: 120,323,648 L622Q probably damaging Het
Wdfy4 T A 14: 33,100,966 H1347L probably benign Het
Xpo1 A G 11: 23,284,863 I540V probably benign Het
Xylt2 A C 11: 94,669,567 M294R probably benign Het
Zfp788 T G 7: 41,649,075 Y326* probably null Het
Zim1 A G 7: 6,682,125 F109L probably benign Het
Other mutations in Ecm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Ecm1 APN 3 95734899 missense probably damaging 1.00
IGL01686:Ecm1 APN 3 95736064 missense probably benign
IGL01807:Ecm1 APN 3 95736579 missense probably damaging 1.00
IGL01862:Ecm1 APN 3 95734273 missense probably benign 0.08
IGL02006:Ecm1 APN 3 95734244 missense probably damaging 0.98
IGL02134:Ecm1 APN 3 95736187 missense probably damaging 1.00
IGL02210:Ecm1 APN 3 95735977 missense probably damaging 0.97
IGL02813:Ecm1 APN 3 95736786 missense probably damaging 0.99
IGL02959:Ecm1 APN 3 95737677 missense probably damaging 1.00
R0362:Ecm1 UTSW 3 95737057 missense possibly damaging 0.93
R0963:Ecm1 UTSW 3 95736588 missense possibly damaging 0.95
R1181:Ecm1 UTSW 3 95735350 missense possibly damaging 0.85
R1230:Ecm1 UTSW 3 95735426 splice site probably null
R1484:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1559:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1561:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1562:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1590:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1591:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R2110:Ecm1 UTSW 3 95735942 missense probably benign 0.14
R3236:Ecm1 UTSW 3 95734846 missense possibly damaging 0.71
R3897:Ecm1 UTSW 3 95735986 missense probably damaging 0.99
R4084:Ecm1 UTSW 3 95734363 missense probably damaging 0.98
R4770:Ecm1 UTSW 3 95737961 unclassified probably benign
R4985:Ecm1 UTSW 3 95736103 missense possibly damaging 0.55
R5506:Ecm1 UTSW 3 95735857 missense probably benign 0.00
R5861:Ecm1 UTSW 3 95736597 missense probably damaging 1.00
R7472:Ecm1 UTSW 3 95735320 missense possibly damaging 0.93
R7678:Ecm1 UTSW 3 95736182 missense probably damaging 0.97
R7704:Ecm1 UTSW 3 95736531 missense probably damaging 0.99
R7864:Ecm1 UTSW 3 95734376 missense probably benign 0.09
Z1088:Ecm1 UTSW 3 95734876 missense probably benign
Z1176:Ecm1 UTSW 3 95734876 missense probably benign
Z1177:Ecm1 UTSW 3 95734876 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTGGATGACAGACACAACGGAC -3'
(R):5'- ATGCAATGACCCAATTTTGTGAGGC -3'

Sequencing Primer
(F):5'- acacaacggacggatgg -3'
(R):5'- AGGCCGAATTCTCTGTCAAG -3'
Posted On2014-03-28