Incidental Mutation 'R1483:Adam12'
ID165701
Institutional Source Beutler Lab
Gene Symbol Adam12
Ensembl Gene ENSMUSG00000054555
Gene Namea disintegrin and metallopeptidase domain 12 (meltrin alpha)
SynonymsMltna, ADAM12
MMRRC Submission 039536-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R1483 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location133883199-134232146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 133930025 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 494 (T494S)
Ref Sequence ENSEMBL: ENSMUSP00000065213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067680] [ENSMUST00000138363]
Predicted Effect probably benign
Transcript: ENSMUST00000067680
AA Change: T494S

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065213
Gene: ENSMUSG00000054555
AA Change: T494S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 165 1.1e-27 PFAM
Pfam:Reprolysin_5 210 392 2.1e-24 PFAM
Pfam:Reprolysin_4 210 408 3.8e-16 PFAM
Pfam:Reprolysin 212 414 1.4e-74 PFAM
Pfam:Reprolysin_2 232 404 6e-18 PFAM
Pfam:Reprolysin_3 236 359 1.3e-16 PFAM
DISIN 431 506 4.29e-42 SMART
ACR 507 650 1.75e-67 SMART
transmembrane domain 705 727 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138363
AA Change: T172S

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114874
Gene: ENSMUSG00000054555
AA Change: T172S

DomainStartEndE-ValueType
Pfam:Reprolysin 4 92 4.5e-24 PFAM
Pfam:Reprolysin_2 6 82 2.1e-11 PFAM
Pfam:Reprolysin_5 9 70 2.8e-11 PFAM
Pfam:Reprolysin_4 11 87 8.9e-8 PFAM
DISIN 109 184 4.29e-42 SMART
ACR 185 328 1.75e-67 SMART
transmembrane domain 383 405 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein that localizes to the cell surface. About a third of the mice lacking the encoded protein die before weaning. Overexpression of the encoded protein in a mouse model of Duchenne muscular dystrophy alleviates the muscle pathology by preventing cell necrosis and inflammation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mice display partial postnatal lethality, decreased brown fat, and impaired formation of neck and interscapular muscles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,903 S368T probably damaging Het
9930021J03Rik G A 19: 29,719,345 P916L possibly damaging Het
Akap6 C T 12: 52,796,087 P73S probably damaging Het
Amotl2 A T 9: 102,730,897 T763S probably benign Het
C87499 T A 4: 88,628,834 Q116L probably damaging Het
Cdc5l A T 17: 45,408,364 V541D possibly damaging Het
Chl1 A G 6: 103,647,287 Y52C probably damaging Het
D6Wsu163e A G 6: 126,954,770 E255G probably benign Het
Ddhd2 A G 8: 25,753,128 S126P probably benign Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Drc3 A G 11: 60,388,889 I427V probably benign Het
Drg2 T C 11: 60,459,527 I104T probably damaging Het
Dst C T 1: 34,252,998 A932V probably damaging Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Eif3a A T 19: 60,768,726 D880E unknown Het
Elf1 T A 14: 79,580,638 D569E probably benign Het
Esp6 T A 17: 40,562,925 M1K probably null Het
Fer1l6 T C 15: 58,637,970 V1427A possibly damaging Het
Gm17689 G A 9: 36,581,324 S95L probably benign Het
Gsta1 A T 9: 78,242,493 K196M probably damaging Het
Gzme T A 14: 56,118,712 I110F probably damaging Het
H2-DMa T A 17: 34,135,750 V27E possibly damaging Het
H2-T10 A T 17: 36,121,146 S2T probably benign Het
Hadhb A G 5: 30,169,494 probably null Het
Hoxa11 G T 6: 52,243,456 D282E probably damaging Het
Ifit1bl1 A G 19: 34,594,641 Y139H possibly damaging Het
Ift27 A G 15: 78,165,236 V88A possibly damaging Het
Knop1 C T 7: 118,853,050 A149T probably damaging Het
Macf1 T A 4: 123,510,977 K597I probably damaging Het
Med16 A T 10: 79,903,100 I284N possibly damaging Het
Melk T A 4: 44,308,937 I98K probably damaging Het
Mst1 G T 9: 108,081,650 G127V probably benign Het
Nacad A G 11: 6,602,217 S325P probably damaging Het
Nbea G A 3: 56,002,790 P1328L probably benign Het
Nek5 C T 8: 22,096,790 S335N probably benign Het
Nif3l1 C A 1: 58,447,726 R24S probably benign Het
Nlrp14 T G 7: 107,190,122 N39K possibly damaging Het
Nup50 T A 15: 84,939,727 V427D probably damaging Het
Nwd1 C T 8: 72,657,086 P78L probably damaging Het
Olfr1431 T A 19: 12,209,750 Y61* probably null Het
Pnkd A G 1: 74,349,391 Y242C probably benign Het
Ppm1g T C 5: 31,203,121 D423G probably benign Het
Prkci A T 3: 31,043,792 N464Y probably damaging Het
Ptprf C T 4: 118,235,964 V494M possibly damaging Het
Rapgef4 T G 2: 72,055,026 probably null Het
Rbak T C 5: 143,174,344 E318G probably damaging Het
Rora A G 9: 69,364,385 D215G probably benign Het
Rp1l1 C T 14: 64,029,047 T694I possibly damaging Het
Scrib A G 15: 76,057,922 L1032P probably damaging Het
Sectm1b G A 11: 121,055,826 T81M probably benign Het
Sgk3 T C 1: 9,872,293 F97L possibly damaging Het
Socs3 A T 11: 117,967,568 Y221* probably null Het
Tdrd6 T A 17: 43,627,607 H850L probably benign Het
Tex44 G T 1: 86,427,186 Q272H probably damaging Het
Tgfbr2 A C 9: 116,109,557 S426A probably benign Het
Tmem39b T C 4: 129,676,663 Y461C probably damaging Het
Ttn T A 2: 76,724,993 D30556V probably damaging Het
Tubgcp5 T A 7: 55,825,707 probably null Het
Vmn2r70 T C 7: 85,559,167 I701V probably benign Het
Vps39 A T 2: 120,323,648 L622Q probably damaging Het
Wdfy4 T A 14: 33,100,966 H1347L probably benign Het
Xpo1 A G 11: 23,284,863 I540V probably benign Het
Xylt2 A C 11: 94,669,567 M294R probably benign Het
Zfp788 T G 7: 41,649,075 Y326* probably null Het
Zim1 A G 7: 6,682,125 F109L probably benign Het
Other mutations in Adam12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Adam12 APN 7 133909881 missense possibly damaging 0.51
IGL01403:Adam12 APN 7 133919610 missense probably benign 0.00
IGL01482:Adam12 APN 7 133967848 missense probably damaging 1.00
IGL01922:Adam12 APN 7 133937472 nonsense probably null
IGL02397:Adam12 APN 7 133909819 splice site probably benign
IGL03401:Adam12 APN 7 133916463 missense probably damaging 1.00
R0122:Adam12 UTSW 7 134012348 missense probably benign 0.45
R0200:Adam12 UTSW 7 133974416 splice site probably null
R0463:Adam12 UTSW 7 133974416 splice site probably null
R0927:Adam12 UTSW 7 133998230 missense probably damaging 1.00
R1258:Adam12 UTSW 7 133937447 missense probably damaging 1.00
R1440:Adam12 UTSW 7 133931814 missense probably benign 0.03
R1692:Adam12 UTSW 7 133887944 makesense probably null
R1797:Adam12 UTSW 7 133967861 missense probably benign 0.03
R2134:Adam12 UTSW 7 134012288 nonsense probably null
R2230:Adam12 UTSW 7 133919618 missense probably damaging 1.00
R2350:Adam12 UTSW 7 133919524 missense probably damaging 1.00
R2944:Adam12 UTSW 7 133975507 missense probably null 0.02
R3688:Adam12 UTSW 7 133964796 nonsense probably null
R3747:Adam12 UTSW 7 134172865 missense probably damaging 0.96
R3749:Adam12 UTSW 7 134172865 missense probably damaging 0.96
R3750:Adam12 UTSW 7 134172865 missense probably damaging 0.96
R4028:Adam12 UTSW 7 133929996 missense probably damaging 1.00
R4130:Adam12 UTSW 7 133912924 missense probably damaging 1.00
R4131:Adam12 UTSW 7 133912924 missense probably damaging 1.00
R4346:Adam12 UTSW 7 133981535 missense possibly damaging 0.82
R4701:Adam12 UTSW 7 133916462 missense possibly damaging 0.64
R4887:Adam12 UTSW 7 134172821 missense possibly damaging 0.74
R5355:Adam12 UTSW 7 133887942 makesense probably null
R5468:Adam12 UTSW 7 133975473 missense probably damaging 1.00
R5486:Adam12 UTSW 7 133907672 missense possibly damaging 0.75
R5990:Adam12 UTSW 7 133931736 missense probably damaging 1.00
R6504:Adam12 UTSW 7 133929984 missense probably damaging 1.00
R6783:Adam12 UTSW 7 133974397 missense probably damaging 1.00
R7117:Adam12 UTSW 7 133916462 missense probably benign 0.00
R7263:Adam12 UTSW 7 133919511 missense possibly damaging 0.68
R7749:Adam12 UTSW 7 134224813 missense unknown
R7820:Adam12 UTSW 7 133998188 missense probably benign 0.00
R7880:Adam12 UTSW 7 133909962 missense possibly damaging 0.94
R7891:Adam12 UTSW 7 133998232 missense probably benign 0.00
R8114:Adam12 UTSW 7 133967888 missense probably damaging 1.00
R8160:Adam12 UTSW 7 133968041 splice site probably null
X0057:Adam12 UTSW 7 134012315 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGCACTCAAGGATGAATCCTCC -3'
(R):5'- TGAAATCCCCACCTGTTTGTGTGAC -3'

Sequencing Primer
(F):5'- GGATGAATCCTCCTCCAAGG -3'
(R):5'- AGGGTGCTTCCTTCTACTTG -3'
Posted On2014-03-28