Mutagenetix > Incidental Mutations

Incidental Mutation 'R1483:Wdfy4'

165725

Institutional Source

Beutler Lab

Gene Symbol

Wdfy4

Ensembl Gene

ENSMUSG00000051506

Gene Name

WD repeat and FYVE domain containing 4

Synonyms

MMRRC Submission

039536-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1483 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32959547-33185508 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 33100966 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1347 (H1347L)

Ref Sequence

ENSEMBL: ENSMUSP00000057556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]

Predicted Effect

probably benign
Transcript: ENSMUST00000061753
AA Change: H1347L

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: H1347L

Domain	Start	End	E-Value	Type
low complexity region	69	77	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	508	522	N/A	INTRINSIC
low complexity region	618	632	N/A	INTRINSIC
low complexity region	644	661	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
low complexity region	1899	1909	N/A	INTRINSIC
Pfam:PH_BEACH	2237	2348	1.2e-9	PFAM
Beach	2378	2660	3.69e-196	SMART
WD40	2761	2801	1.98e1	SMART
WD40	2811	2850	5.18e-7	SMART
WD40	2853	2891	9.94e-1	SMART
WD40	2893	2940	3.17e-2	SMART
WD40	2986	3021	3.31e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130509
AA Change: H1392L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: H1392L

Domain	Start	End	E-Value	Type
low complexity region	69	77	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	508	522	N/A	INTRINSIC
low complexity region	618	632	N/A	INTRINSIC
low complexity region	644	661	N/A	INTRINSIC
low complexity region	1596	1615	N/A	INTRINSIC
low complexity region	1795	1819	N/A	INTRINSIC
low complexity region	2019	2029	N/A	INTRINSIC
Pfam:PH_BEACH	2362	2473	1.2e-9	PFAM
Beach	2503	2785	3.69e-196	SMART
WD40	2886	2926	1.98e1	SMART
WD40	2936	2975	5.18e-7	SMART
WD40	2978	3016	9.94e-1	SMART
WD40	3018	3065	3.17e-2	SMART
WD40	3111	3146	3.31e0	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,742,903	S368T	probably damaging	Het
9930021J03Rik	G	A	19: 29,719,345	P916L	possibly damaging	Het
Adam12	T	A	7: 133,930,025	T494S	probably benign	Het
Akap6	C	T	12: 52,796,087	P73S	probably damaging	Het
Amotl2	A	T	9: 102,730,897	T763S	probably benign	Het
C87499	T	A	4: 88,628,834	Q116L	probably damaging	Het
Cdc5l	A	T	17: 45,408,364	V541D	possibly damaging	Het
Chl1	A	G	6: 103,647,287	Y52C	probably damaging	Het
D6Wsu163e	A	G	6: 126,954,770	E255G	probably benign	Het
Ddhd2	A	G	8: 25,753,128	S126P	probably benign	Het
Dner	CGCTGCTGCTGCTGCTGCTGCTGCTGC	CGCTGCTGCTGCTGCTGCTGCTGC	1: 84,585,549		probably benign	Het
Drc3	A	G	11: 60,388,889	I427V	probably benign	Het
Drg2	T	C	11: 60,459,527	I104T	probably damaging	Het
Dst	C	T	1: 34,252,998	A932V	probably damaging	Het
Ecm1	G	A	3: 95,735,963	R342C	probably damaging	Het
Eif3a	A	T	19: 60,768,726	D880E	unknown	Het
Elf1	T	A	14: 79,580,638	D569E	probably benign	Het
Esp6	T	A	17: 40,562,925	M1K	probably null	Het
Fer1l6	T	C	15: 58,637,970	V1427A	possibly damaging	Het
Gm17689	G	A	9: 36,581,324	S95L	probably benign	Het
Gsta1	A	T	9: 78,242,493	K196M	probably damaging	Het
Gzme	T	A	14: 56,118,712	I110F	probably damaging	Het
H2-DMa	T	A	17: 34,135,750	V27E	possibly damaging	Het
H2-T10	A	T	17: 36,121,146	S2T	probably benign	Het
Hadhb	A	G	5: 30,169,494		probably null	Het
Hoxa11	G	T	6: 52,243,456	D282E	probably damaging	Het
Ifit1bl1	A	G	19: 34,594,641	Y139H	possibly damaging	Het
Ift27	A	G	15: 78,165,236	V88A	possibly damaging	Het
Knop1	C	T	7: 118,853,050	A149T	probably damaging	Het
Macf1	T	A	4: 123,510,977	K597I	probably damaging	Het
Med16	A	T	10: 79,903,100	I284N	possibly damaging	Het
Melk	T	A	4: 44,308,937	I98K	probably damaging	Het
Mst1	G	T	9: 108,081,650	G127V	probably benign	Het
Nacad	A	G	11: 6,602,217	S325P	probably damaging	Het
Nbea	G	A	3: 56,002,790	P1328L	probably benign	Het
Nek5	C	T	8: 22,096,790	S335N	probably benign	Het
Nif3l1	C	A	1: 58,447,726	R24S	probably benign	Het
Nlrp14	T	G	7: 107,190,122	N39K	possibly damaging	Het
Nup50	T	A	15: 84,939,727	V427D	probably damaging	Het
Nwd1	C	T	8: 72,657,086	P78L	probably damaging	Het
Olfr1431	T	A	19: 12,209,750	Y61*	probably null	Het
Pnkd	A	G	1: 74,349,391	Y242C	probably benign	Het
Ppm1g	T	C	5: 31,203,121	D423G	probably benign	Het
Prkci	A	T	3: 31,043,792	N464Y	probably damaging	Het
Ptprf	C	T	4: 118,235,964	V494M	possibly damaging	Het
Rapgef4	T	G	2: 72,055,026		probably null	Het
Rbak	T	C	5: 143,174,344	E318G	probably damaging	Het
Rora	A	G	9: 69,364,385	D215G	probably benign	Het
Rp1l1	C	T	14: 64,029,047	T694I	possibly damaging	Het
Scrib	A	G	15: 76,057,922	L1032P	probably damaging	Het
Sectm1b	G	A	11: 121,055,826	T81M	probably benign	Het
Sgk3	T	C	1: 9,872,293	F97L	possibly damaging	Het
Socs3	A	T	11: 117,967,568	Y221*	probably null	Het
Tdrd6	T	A	17: 43,627,607	H850L	probably benign	Het
Tex44	G	T	1: 86,427,186	Q272H	probably damaging	Het
Tgfbr2	A	C	9: 116,109,557	S426A	probably benign	Het
Tmem39b	T	C	4: 129,676,663	Y461C	probably damaging	Het
Ttn	T	A	2: 76,724,993	D30556V	probably damaging	Het
Tubgcp5	T	A	7: 55,825,707		probably null	Het
Vmn2r70	T	C	7: 85,559,167	I701V	probably benign	Het
Vps39	A	T	2: 120,323,648	L622Q	probably damaging	Het
Xpo1	A	G	11: 23,284,863	I540V	probably benign	Het
Xylt2	A	C	11: 94,669,567	M294R	probably benign	Het
Zfp788	T	G	7: 41,649,075	Y326*	probably null	Het
Zim1	A	G	7: 6,682,125	F109L	probably benign	Het

Other mutations in Wdfy4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Wdfy4	APN	14	33102539	missense	possibly damaging	0.93
IGL01116:Wdfy4	APN	14	32959977	missense	probably damaging	1.00
IGL01449:Wdfy4	APN	14	33104037	missense	probably damaging	0.99
IGL01567:Wdfy4	APN	14	33151661	missense	probably benign	0.01
IGL01700:Wdfy4	APN	14	33020238	splice site	probably benign
IGL01931:Wdfy4	APN	14	33155753	missense	probably damaging	1.00
IGL01981:Wdfy4	APN	14	33133716	missense	probably damaging	1.00
IGL01988:Wdfy4	APN	14	33076480	missense	possibly damaging	0.75
IGL02026:Wdfy4	APN	14	33093300	missense	probably damaging	1.00
IGL02066:Wdfy4	APN	14	33149566	missense	probably benign
IGL02468:Wdfy4	APN	14	32966432	missense	probably benign	0.01
IGL02512:Wdfy4	APN	14	33042491	missense	probably benign	0.01
IGL02597:Wdfy4	APN	14	33090861	nonsense	probably null
IGL02752:Wdfy4	APN	14	33076326	missense	probably damaging	1.00
IGL02792:Wdfy4	APN	14	33095305	missense	probably benign	0.01
IGL02826:Wdfy4	APN	14	32971750	missense	possibly damaging	0.47
IGL02903:Wdfy4	APN	14	33109650	missense	probably damaging	1.00
IGL02955:Wdfy4	APN	14	33076284	missense	probably damaging	1.00
IGL03031:Wdfy4	APN	14	33140651	missense	probably damaging	1.00
IGL03102:Wdfy4	APN	14	32966435	missense	probably damaging	1.00
IGL03123:Wdfy4	APN	14	33162870	missense	probably benign	0.01
IGL03198:Wdfy4	APN	14	33125887	missense	probably damaging	1.00
IGL03250:Wdfy4	APN	14	32977167	missense	probably damaging	0.99
IGL03277:Wdfy4	APN	14	33068904	missense	probably benign	0.01
IGL03398:Wdfy4	APN	14	33047290	missense	probably benign	0.14
Dollar	UTSW	14	33020311	missense	probably damaging	1.00
Giants	UTSW	14	33070618	nonsense	probably null
kings_canyon	UTSW	14	33109519	nonsense	probably null
moro	UTSW	14	32964626	splice site	probably null
sequoia	UTSW	14	33100903	critical splice donor site	probably null
Sherman	UTSW	14	33095951	missense	possibly damaging	0.89
watchtower	UTSW	14	33083639	critical splice donor site	probably null
R0014:Wdfy4	UTSW	14	33107173	missense	possibly damaging	0.72
R0067:Wdfy4	UTSW	14	33162751	missense	probably null	1.00
R0085:Wdfy4	UTSW	14	33078243	missense	possibly damaging	0.81
R0277:Wdfy4	UTSW	14	33083785	missense	possibly damaging	0.83
R0436:Wdfy4	UTSW	14	33083812	splice site	probably benign
R0496:Wdfy4	UTSW	14	33140738	splice site	probably benign
R0514:Wdfy4	UTSW	14	33080775	missense	probably benign	0.22
R0548:Wdfy4	UTSW	14	33042621	missense	probably benign
R0590:Wdfy4	UTSW	14	33041174	missense	probably benign	0.09
R0647:Wdfy4	UTSW	14	33109699	missense	possibly damaging	0.96
R0766:Wdfy4	UTSW	14	33140612	missense	probably damaging	1.00
R0981:Wdfy4	UTSW	14	33147092	missense	probably benign	0.03
R1024:Wdfy4	UTSW	14	33079966	missense	possibly damaging	0.81
R1113:Wdfy4	UTSW	14	32971738	missense	possibly damaging	0.47
R1252:Wdfy4	UTSW	14	32971772	splice site	probably null
R1415:Wdfy4	UTSW	14	33041180	missense	possibly damaging	0.60
R1475:Wdfy4	UTSW	14	33108688	missense	probably benign	0.14
R1490:Wdfy4	UTSW	14	33152538	critical splice donor site	probably null
R1512:Wdfy4	UTSW	14	32960808	missense	probably damaging	0.98
R1615:Wdfy4	UTSW	14	33042512	missense	probably damaging	1.00
R1628:Wdfy4	UTSW	14	32959961	missense	probably damaging	1.00
R1643:Wdfy4	UTSW	14	33073585	critical splice acceptor site	probably null
R1729:Wdfy4	UTSW	14	33096005	missense	possibly damaging	0.85
R1859:Wdfy4	UTSW	14	33103983	missense	probably damaging	0.99
R1933:Wdfy4	UTSW	14	33133344	missense	probably benign	0.08
R1957:Wdfy4	UTSW	14	32971684	missense	probably damaging	1.00
R1968:Wdfy4	UTSW	14	33106044	missense	possibly damaging	0.95
R2032:Wdfy4	UTSW	14	33146989	missense	probably benign	0.11
R2241:Wdfy4	UTSW	14	33073511	missense	possibly damaging	0.81
R2391:Wdfy4	UTSW	14	33162807	missense	possibly damaging	0.92
R2888:Wdfy4	UTSW	14	33109519	nonsense	probably null
R2889:Wdfy4	UTSW	14	33109519	nonsense	probably null
R3114:Wdfy4	UTSW	14	33089903	missense	probably damaging	0.97
R3757:Wdfy4	UTSW	14	33023374	missense	probably benign	0.17
R3758:Wdfy4	UTSW	14	33023374	missense	probably benign	0.17
R3797:Wdfy4	UTSW	14	33140645	missense	probably damaging	1.00
R3890:Wdfy4	UTSW	14	33047280	missense	probably damaging	1.00
R3892:Wdfy4	UTSW	14	33047280	missense	probably damaging	1.00
R3945:Wdfy4	UTSW	14	32966395	missense	probably damaging	0.99
R4011:Wdfy4	UTSW	14	33102680	splice site	probably benign
R4091:Wdfy4	UTSW	14	33125880	missense	possibly damaging	0.93
R4449:Wdfy4	UTSW	14	33096083	missense	probably damaging	1.00
R4585:Wdfy4	UTSW	14	33087955	missense	possibly damaging	0.89
R4628:Wdfy4	UTSW	14	33102558	missense	probably damaging	0.97
R4629:Wdfy4	UTSW	14	33102558	missense	probably damaging	0.97
R4655:Wdfy4	UTSW	14	32989936	missense	probably damaging	0.98
R4689:Wdfy4	UTSW	14	33109548	missense	possibly damaging	0.88
R4718:Wdfy4	UTSW	14	33145316	missense	probably benign	0.03
R4862:Wdfy4	UTSW	14	33100903	critical splice donor site	probably null
R4884:Wdfy4	UTSW	14	32988895	nonsense	probably null
R4894:Wdfy4	UTSW	14	33155760	missense	probably benign	0.03
R4929:Wdfy4	UTSW	14	33047256	missense	possibly damaging	0.90
R4932:Wdfy4	UTSW	14	33029013	missense	probably damaging	1.00
R5014:Wdfy4	UTSW	14	33100940	missense	probably benign	0.02
R5020:Wdfy4	UTSW	14	33079935	missense	probably damaging	1.00
R5049:Wdfy4	UTSW	14	33152670	missense	possibly damaging	0.78
R5276:Wdfy4	UTSW	14	33047275	missense	probably damaging	1.00
R5318:Wdfy4	UTSW	14	33078343	missense	possibly damaging	0.95
R5338:Wdfy4	UTSW	14	33090866	missense	probably damaging	1.00
R5349:Wdfy4	UTSW	14	32988899	missense	probably damaging	1.00
R5411:Wdfy4	UTSW	14	32960002	missense	probably damaging	1.00
R5435:Wdfy4	UTSW	14	33020311	missense	probably damaging	1.00
R5463:Wdfy4	UTSW	14	33151732	missense	probably benign	0.17
R5591:Wdfy4	UTSW	14	33107130	missense	probably benign	0.09
R5598:Wdfy4	UTSW	14	33133497	missense	probably damaging	1.00
R5654:Wdfy4	UTSW	14	33107618	splice site	probably null
R5890:Wdfy4	UTSW	14	33102577	missense	possibly damaging	0.91
R5894:Wdfy4	UTSW	14	33133360	missense	possibly damaging	0.86
R5964:Wdfy4	UTSW	14	33106011	missense	probably damaging	1.00
R6036:Wdfy4	UTSW	14	33146990	missense	probably damaging	0.97
R6036:Wdfy4	UTSW	14	33146990	missense	probably damaging	0.97
R6074:Wdfy4	UTSW	14	33083639	critical splice donor site	probably null
R6135:Wdfy4	UTSW	14	32971711	missense	probably damaging	0.99
R6276:Wdfy4	UTSW	14	33109525	missense	possibly damaging	0.54
R6357:Wdfy4	UTSW	14	33101049	nonsense	probably null
R6370:Wdfy4	UTSW	14	33068850	missense	probably benign	0.16
R6390:Wdfy4	UTSW	14	33104094	missense	probably damaging	0.99
R6413:Wdfy4	UTSW	14	32967647	missense	probably damaging	1.00
R6450:Wdfy4	UTSW	14	33108692	missense	probably damaging	1.00
R6522:Wdfy4	UTSW	14	33146944	missense	probably damaging	0.98
R6657:Wdfy4	UTSW	14	33047251	missense	possibly damaging	0.70
R6761:Wdfy4	UTSW	14	33095951	missense	possibly damaging	0.89
R6763:Wdfy4	UTSW	14	33042512	missense	probably damaging	1.00
R6952:Wdfy4	UTSW	14	32959966	missense	probably damaging	1.00
R6985:Wdfy4	UTSW	14	33099117	missense	possibly damaging	0.68
R7024:Wdfy4	UTSW	14	32964626	splice site	probably null
R7101:Wdfy4	UTSW	14	32960820	missense
R7114:Wdfy4	UTSW	14	32971574	splice site	probably null
R7139:Wdfy4	UTSW	14	33151578	missense
R7255:Wdfy4	UTSW	14	32974282	missense
R7324:Wdfy4	UTSW	14	33047314	missense
R7379:Wdfy4	UTSW	14	33151609	missense
R7399:Wdfy4	UTSW	14	33068906	missense
R7408:Wdfy4	UTSW	14	33078307	missense
R7410:Wdfy4	UTSW	14	32974234	missense
R7411:Wdfy4	UTSW	14	33106131	missense
R7412:Wdfy4	UTSW	14	33149584	missense
R7445:Wdfy4	UTSW	14	33070618	nonsense	probably null
R7595:Wdfy4	UTSW	14	32974154	critical splice donor site	probably null
R7618:Wdfy4	UTSW	14	32985739	missense
R7622:Wdfy4	UTSW	14	33078274	missense
R7828:Wdfy4	UTSW	14	32988921	missense	possibly damaging	0.90
R7888:Wdfy4	UTSW	14	33090963	missense
R7971:Wdfy4	UTSW	14	33090963	missense
R8001:Wdfy4	UTSW	14	32973535	critical splice donor site	unknown
R8010:Wdfy4	UTSW	14	32971627	missense	not run
R8015:Wdfy4	UTSW	14	33107747	missense	not run
R8032:Wdfy4	UTSW	14	33029086	nonsense	probably null
R8041:Wdfy4	UTSW	14	33154008	critical splice donor site	unknown
X0028:Wdfy4	UTSW	14	33080636	missense	probably benign
X0053:Wdfy4	UTSW	14	33162942	start codon destroyed	probably null	0.99
X0062:Wdfy4	UTSW	14	33107618	splice site	probably null
Z1177:Wdfy4	UTSW	14	33087985	missense	not run

Predicted Primers

PCR Primer
(F):5'- TTCCGACCTACTGGGGCAAAAGAG -3'
(R):5'- CCAGCCTATCCTGTTGCATGAGAC -3'

Sequencing Primer
(F):5'- GAGGCAGGCATATCCTGG -3'
(R):5'- AACTGCCAGGAGTGCTGTATC -3'

Posted On

2014-03-28