Incidental Mutation 'R1483:Nup50'
ID165732
Institutional Source Beutler Lab
Gene Symbol Nup50
Ensembl Gene ENSMUSG00000016619
Gene Namenucleoporin 50
Synonyms1700030K07Rik, Npap60
MMRRC Submission 039536-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1483 (G1)
Quality Score175
Status Not validated
Chromosome15
Chromosomal Location84923411-84942963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84939727 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 427 (V427D)
Ref Sequence ENSEMBL: ENSMUSP00000155656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047144] [ENSMUST00000165443] [ENSMUST00000230411]
Predicted Effect probably benign
Transcript: ENSMUST00000047144
SMART Domains Protein: ENSMUSP00000037011
Gene: ENSMUSG00000036046

DomainStartEndE-ValueType
Pfam:DUF2045 25 264 7.4e-123 PFAM
low complexity region 347 362 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165443
AA Change: V427D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131457
Gene: ENSMUSG00000016619
AA Change: V427D

DomainStartEndE-ValueType
Pfam:NUP50 2 80 1.2e-22 PFAM
low complexity region 277 302 N/A INTRINSIC
RanBD 340 463 4.83e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000230411
AA Change: V427D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a member of the FG-repeat containing nucleoporins that functions as a soluble cofactor in importin-alpha:beta-mediated nuclear protein import. Pseudogenes of this gene are found on chromosomes 5, 6, and 14. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation die perinatally, displaying neural tube defects, exencephaly, and intrauterine growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,903 S368T probably damaging Het
9930021J03Rik G A 19: 29,719,345 P916L possibly damaging Het
Adam12 T A 7: 133,930,025 T494S probably benign Het
Akap6 C T 12: 52,796,087 P73S probably damaging Het
Amotl2 A T 9: 102,730,897 T763S probably benign Het
C87499 T A 4: 88,628,834 Q116L probably damaging Het
Cdc5l A T 17: 45,408,364 V541D possibly damaging Het
Chl1 A G 6: 103,647,287 Y52C probably damaging Het
D6Wsu163e A G 6: 126,954,770 E255G probably benign Het
Ddhd2 A G 8: 25,753,128 S126P probably benign Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Drc3 A G 11: 60,388,889 I427V probably benign Het
Drg2 T C 11: 60,459,527 I104T probably damaging Het
Dst C T 1: 34,252,998 A932V probably damaging Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Eif3a A T 19: 60,768,726 D880E unknown Het
Elf1 T A 14: 79,580,638 D569E probably benign Het
Esp6 T A 17: 40,562,925 M1K probably null Het
Fer1l6 T C 15: 58,637,970 V1427A possibly damaging Het
Gm17689 G A 9: 36,581,324 S95L probably benign Het
Gsta1 A T 9: 78,242,493 K196M probably damaging Het
Gzme T A 14: 56,118,712 I110F probably damaging Het
H2-DMa T A 17: 34,135,750 V27E possibly damaging Het
H2-T10 A T 17: 36,121,146 S2T probably benign Het
Hadhb A G 5: 30,169,494 probably null Het
Hoxa11 G T 6: 52,243,456 D282E probably damaging Het
Ifit1bl1 A G 19: 34,594,641 Y139H possibly damaging Het
Ift27 A G 15: 78,165,236 V88A possibly damaging Het
Knop1 C T 7: 118,853,050 A149T probably damaging Het
Macf1 T A 4: 123,510,977 K597I probably damaging Het
Med16 A T 10: 79,903,100 I284N possibly damaging Het
Melk T A 4: 44,308,937 I98K probably damaging Het
Mst1 G T 9: 108,081,650 G127V probably benign Het
Nacad A G 11: 6,602,217 S325P probably damaging Het
Nbea G A 3: 56,002,790 P1328L probably benign Het
Nek5 C T 8: 22,096,790 S335N probably benign Het
Nif3l1 C A 1: 58,447,726 R24S probably benign Het
Nlrp14 T G 7: 107,190,122 N39K possibly damaging Het
Nwd1 C T 8: 72,657,086 P78L probably damaging Het
Olfr1431 T A 19: 12,209,750 Y61* probably null Het
Pnkd A G 1: 74,349,391 Y242C probably benign Het
Ppm1g T C 5: 31,203,121 D423G probably benign Het
Prkci A T 3: 31,043,792 N464Y probably damaging Het
Ptprf C T 4: 118,235,964 V494M possibly damaging Het
Rapgef4 T G 2: 72,055,026 probably null Het
Rbak T C 5: 143,174,344 E318G probably damaging Het
Rora A G 9: 69,364,385 D215G probably benign Het
Rp1l1 C T 14: 64,029,047 T694I possibly damaging Het
Scrib A G 15: 76,057,922 L1032P probably damaging Het
Sectm1b G A 11: 121,055,826 T81M probably benign Het
Sgk3 T C 1: 9,872,293 F97L possibly damaging Het
Socs3 A T 11: 117,967,568 Y221* probably null Het
Tdrd6 T A 17: 43,627,607 H850L probably benign Het
Tex44 G T 1: 86,427,186 Q272H probably damaging Het
Tgfbr2 A C 9: 116,109,557 S426A probably benign Het
Tmem39b T C 4: 129,676,663 Y461C probably damaging Het
Ttn T A 2: 76,724,993 D30556V probably damaging Het
Tubgcp5 T A 7: 55,825,707 probably null Het
Vmn2r70 T C 7: 85,559,167 I701V probably benign Het
Vps39 A T 2: 120,323,648 L622Q probably damaging Het
Wdfy4 T A 14: 33,100,966 H1347L probably benign Het
Xpo1 A G 11: 23,284,863 I540V probably benign Het
Xylt2 A C 11: 94,669,567 M294R probably benign Het
Zfp788 T G 7: 41,649,075 Y326* probably null Het
Zim1 A G 7: 6,682,125 F109L probably benign Het
Other mutations in Nup50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Nup50 APN 15 84935404 missense probably benign 0.33
IGL00939:Nup50 APN 15 84938420 nonsense probably null
R1545:Nup50 UTSW 15 84939792 missense possibly damaging 0.51
R2504:Nup50 UTSW 15 84933658 missense probably benign 0.00
R3005:Nup50 UTSW 15 84929460 splice site probably null
R3690:Nup50 UTSW 15 84939793 missense probably damaging 1.00
R4851:Nup50 UTSW 15 84939711 missense probably benign 0.03
R5902:Nup50 UTSW 15 84935440 missense probably benign 0.00
R7205:Nup50 UTSW 15 84933658 missense probably benign 0.00
R8350:Nup50 UTSW 15 84935275 missense probably benign 0.01
R8450:Nup50 UTSW 15 84935275 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTAAGCGCCTGAAGCTGGAG -3'
(R):5'- AACGTGGCAACATGCCTTGGTC -3'

Sequencing Primer
(F):5'- AGAAGTCGCTTCAGGATTGACTC -3'
(R):5'- ATGCCTTGGTCAGCCTCAG -3'
Posted On2014-03-28