Incidental Mutation 'R1483:Tdrd6'
ID165737
Institutional Source Beutler Lab
Gene Symbol Tdrd6
Ensembl Gene ENSMUSG00000040140
Gene Nametudor domain containing 6
Synonyms
MMRRC Submission 039536-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1483 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location43615335-43630299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43627607 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 850 (H850L)
Ref Sequence ENSEMBL: ENSMUSP00000035338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045717] [ENSMUST00000168073]
Predicted Effect probably benign
Transcript: ENSMUST00000045717
AA Change: H850L

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035338
Gene: ENSMUSG00000040140
AA Change: H850L

DomainStartEndE-ValueType
Pfam:TUDOR 14 133 9.9e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2026 2083 9.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168073
AA Change: H850L

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131277
Gene: ENSMUSG00000040140
AA Change: H850L

DomainStartEndE-ValueType
Pfam:TUDOR 12 133 7.2e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2027 2084 9.45e-1 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tudor domain-containing protein and component of the chromatoid body, a type of ribonucleoprotein granule present in male germ cells. Studies in rodents have demonstrated a role for the encoded protein in spermiogenesis and the nonsense mediated decay (NMD) pathway. This protein is a major autoantigen in human patients with autoimmune polyendocrine syndrome type 1 (APS1). [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit male fertility associated with arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,903 S368T probably damaging Het
9930021J03Rik G A 19: 29,719,345 P916L possibly damaging Het
Adam12 T A 7: 133,930,025 T494S probably benign Het
Akap6 C T 12: 52,796,087 P73S probably damaging Het
Amotl2 A T 9: 102,730,897 T763S probably benign Het
C87499 T A 4: 88,628,834 Q116L probably damaging Het
Cdc5l A T 17: 45,408,364 V541D possibly damaging Het
Chl1 A G 6: 103,647,287 Y52C probably damaging Het
D6Wsu163e A G 6: 126,954,770 E255G probably benign Het
Ddhd2 A G 8: 25,753,128 S126P probably benign Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Drc3 A G 11: 60,388,889 I427V probably benign Het
Drg2 T C 11: 60,459,527 I104T probably damaging Het
Dst C T 1: 34,252,998 A932V probably damaging Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Eif3a A T 19: 60,768,726 D880E unknown Het
Elf1 T A 14: 79,580,638 D569E probably benign Het
Esp6 T A 17: 40,562,925 M1K probably null Het
Fer1l6 T C 15: 58,637,970 V1427A possibly damaging Het
Gm17689 G A 9: 36,581,324 S95L probably benign Het
Gsta1 A T 9: 78,242,493 K196M probably damaging Het
Gzme T A 14: 56,118,712 I110F probably damaging Het
H2-DMa T A 17: 34,135,750 V27E possibly damaging Het
H2-T10 A T 17: 36,121,146 S2T probably benign Het
Hadhb A G 5: 30,169,494 probably null Het
Hoxa11 G T 6: 52,243,456 D282E probably damaging Het
Ifit1bl1 A G 19: 34,594,641 Y139H possibly damaging Het
Ift27 A G 15: 78,165,236 V88A possibly damaging Het
Knop1 C T 7: 118,853,050 A149T probably damaging Het
Macf1 T A 4: 123,510,977 K597I probably damaging Het
Med16 A T 10: 79,903,100 I284N possibly damaging Het
Melk T A 4: 44,308,937 I98K probably damaging Het
Mst1 G T 9: 108,081,650 G127V probably benign Het
Nacad A G 11: 6,602,217 S325P probably damaging Het
Nbea G A 3: 56,002,790 P1328L probably benign Het
Nek5 C T 8: 22,096,790 S335N probably benign Het
Nif3l1 C A 1: 58,447,726 R24S probably benign Het
Nlrp14 T G 7: 107,190,122 N39K possibly damaging Het
Nup50 T A 15: 84,939,727 V427D probably damaging Het
Nwd1 C T 8: 72,657,086 P78L probably damaging Het
Olfr1431 T A 19: 12,209,750 Y61* probably null Het
Pnkd A G 1: 74,349,391 Y242C probably benign Het
Ppm1g T C 5: 31,203,121 D423G probably benign Het
Prkci A T 3: 31,043,792 N464Y probably damaging Het
Ptprf C T 4: 118,235,964 V494M possibly damaging Het
Rapgef4 T G 2: 72,055,026 probably null Het
Rbak T C 5: 143,174,344 E318G probably damaging Het
Rora A G 9: 69,364,385 D215G probably benign Het
Rp1l1 C T 14: 64,029,047 T694I possibly damaging Het
Scrib A G 15: 76,057,922 L1032P probably damaging Het
Sectm1b G A 11: 121,055,826 T81M probably benign Het
Sgk3 T C 1: 9,872,293 F97L possibly damaging Het
Socs3 A T 11: 117,967,568 Y221* probably null Het
Tex44 G T 1: 86,427,186 Q272H probably damaging Het
Tgfbr2 A C 9: 116,109,557 S426A probably benign Het
Tmem39b T C 4: 129,676,663 Y461C probably damaging Het
Ttn T A 2: 76,724,993 D30556V probably damaging Het
Tubgcp5 T A 7: 55,825,707 probably null Het
Vmn2r70 T C 7: 85,559,167 I701V probably benign Het
Vps39 A T 2: 120,323,648 L622Q probably damaging Het
Wdfy4 T A 14: 33,100,966 H1347L probably benign Het
Xpo1 A G 11: 23,284,863 I540V probably benign Het
Xylt2 A C 11: 94,669,567 M294R probably benign Het
Zfp788 T G 7: 41,649,075 Y326* probably null Het
Zim1 A G 7: 6,682,125 F109L probably benign Het
Other mutations in Tdrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tdrd6 APN 17 43628160 missense probably damaging 0.96
IGL00844:Tdrd6 APN 17 43617196 missense probably benign
IGL00845:Tdrd6 APN 17 43626716 missense probably benign 0.06
IGL01558:Tdrd6 APN 17 43625768 missense probably damaging 1.00
IGL01558:Tdrd6 APN 17 43624766 missense probably benign 0.02
IGL01575:Tdrd6 APN 17 43627980 missense probably benign 0.00
IGL01812:Tdrd6 APN 17 43625174 missense probably benign 0.10
IGL02013:Tdrd6 APN 17 43625946 missense probably benign 0.00
IGL02067:Tdrd6 APN 17 43628209 missense probably damaging 1.00
IGL02112:Tdrd6 APN 17 43629351 missense probably damaging 1.00
IGL02159:Tdrd6 APN 17 43628390 missense probably damaging 1.00
IGL02226:Tdrd6 APN 17 43627202 missense probably damaging 1.00
IGL02416:Tdrd6 APN 17 43624738 missense probably benign 0.39
IGL02577:Tdrd6 APN 17 43626837 missense probably damaging 0.99
IGL02631:Tdrd6 APN 17 43626219 missense probably damaging 1.00
IGL02738:Tdrd6 APN 17 43620446 missense probably benign 0.06
IGL02792:Tdrd6 APN 17 43625027 missense probably benign
IGL02929:Tdrd6 APN 17 43629713 missense possibly damaging 0.61
IGL02934:Tdrd6 APN 17 43627887 missense probably benign 0.42
IGL02954:Tdrd6 APN 17 43627262 missense possibly damaging 0.82
IGL02969:Tdrd6 APN 17 43627549 missense probably damaging 0.98
IGL03006:Tdrd6 APN 17 43625432 missense probably damaging 1.00
IGL03155:Tdrd6 APN 17 43625507 missense probably damaging 1.00
IGL03219:Tdrd6 APN 17 43627964 missense probably benign 0.04
IGL03372:Tdrd6 APN 17 43625568 missense probably damaging 1.00
R0030:Tdrd6 UTSW 17 43626591 missense possibly damaging 0.80
R0057:Tdrd6 UTSW 17 43617161 splice site probably benign
R0090:Tdrd6 UTSW 17 43628241 missense probably benign 0.00
R0270:Tdrd6 UTSW 17 43624308 missense probably benign
R0463:Tdrd6 UTSW 17 43625561 missense probably damaging 1.00
R0594:Tdrd6 UTSW 17 43629383 missense probably damaging 1.00
R0650:Tdrd6 UTSW 17 43628159 missense probably damaging 0.99
R1226:Tdrd6 UTSW 17 43626632 missense possibly damaging 0.63
R1309:Tdrd6 UTSW 17 43626621 missense probably benign
R1561:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1574:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1647:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1648:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1723:Tdrd6 UTSW 17 43628327 missense possibly damaging 0.94
R1786:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R1819:Tdrd6 UTSW 17 43626551 missense probably benign 0.00
R1836:Tdrd6 UTSW 17 43625589 missense probably benign 0.03
R1892:Tdrd6 UTSW 17 43624805 missense probably benign 0.00
R1911:Tdrd6 UTSW 17 43627088 missense probably benign 0.21
R1936:Tdrd6 UTSW 17 43626467 missense probably damaging 0.98
R2005:Tdrd6 UTSW 17 43628655 missense probably damaging 1.00
R2006:Tdrd6 UTSW 17 43628655 missense probably damaging 1.00
R2132:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R2133:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R3010:Tdrd6 UTSW 17 43628042 missense probably benign 0.00
R4225:Tdrd6 UTSW 17 43625973 missense probably damaging 1.00
R4448:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4449:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4531:Tdrd6 UTSW 17 43628754 missense probably damaging 0.98
R4624:Tdrd6 UTSW 17 43625990 missense probably damaging 0.99
R4665:Tdrd6 UTSW 17 43624116 missense probably benign
R4676:Tdrd6 UTSW 17 43627610 missense probably damaging 0.96
R4785:Tdrd6 UTSW 17 43625576 missense probably damaging 1.00
R4912:Tdrd6 UTSW 17 43624327 missense probably benign 0.34
R5134:Tdrd6 UTSW 17 43626210 missense probably damaging 1.00
R5145:Tdrd6 UTSW 17 43626075 missense probably damaging 0.96
R5623:Tdrd6 UTSW 17 43629333 missense probably damaging 1.00
R5712:Tdrd6 UTSW 17 43626408 missense probably damaging 1.00
R5897:Tdrd6 UTSW 17 43624877 missense probably damaging 0.98
R5913:Tdrd6 UTSW 17 43628411 missense possibly damaging 0.73
R6142:Tdrd6 UTSW 17 43629482 missense probably benign 0.01
R6181:Tdrd6 UTSW 17 43628897 missense probably damaging 1.00
R6195:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6233:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6289:Tdrd6 UTSW 17 43624520 missense probably benign 0.01
R6315:Tdrd6 UTSW 17 43626338 missense probably benign 0.02
R6578:Tdrd6 UTSW 17 43628961 missense possibly damaging 0.65
R6645:Tdrd6 UTSW 17 43624532 missense probably benign 0.10
R6822:Tdrd6 UTSW 17 43627215 missense probably damaging 1.00
R7000:Tdrd6 UTSW 17 43627708 missense probably benign 0.28
R7075:Tdrd6 UTSW 17 43625174 missense probably benign 0.10
R7107:Tdrd6 UTSW 17 43624204 missense probably benign 0.00
R7381:Tdrd6 UTSW 17 43626093 missense probably benign 0.00
R7458:Tdrd6 UTSW 17 43625046 missense probably benign 0.02
R7461:Tdrd6 UTSW 17 43627926 missense probably benign 0.00
R7505:Tdrd6 UTSW 17 43627679 missense not run
R7583:Tdrd6 UTSW 17 43624238 missense probably benign 0.29
R7613:Tdrd6 UTSW 17 43627926 missense probably benign 0.00
R7723:Tdrd6 UTSW 17 43625960 missense probably benign 0.09
R7759:Tdrd6 UTSW 17 43624839 missense probably benign 0.00
R8002:Tdrd6 UTSW 17 43629819 missense probably damaging 0.98
X0065:Tdrd6 UTSW 17 43625153 missense possibly damaging 0.80
X0065:Tdrd6 UTSW 17 43625993 missense probably damaging 0.99
Z1088:Tdrd6 UTSW 17 43626518 missense probably benign 0.23
Z1177:Tdrd6 UTSW 17 43627187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAACCCGCTGAAAGCCTGTACTG -3'
(R):5'- TGTCTCACATCGAAAACCCTGGCTC -3'

Sequencing Primer
(F):5'- GAAAGCCTGTACTGCCTTTTCATC -3'
(R):5'- GAAAACCCTGGCTCCTTCTGG -3'
Posted On2014-03-28