Incidental Mutation 'R1483:Olfr1431'
ID165741
Institutional Source Beutler Lab
Gene Symbol Olfr1431
Ensembl Gene ENSMUSG00000094133
Gene Nameolfactory receptor 1431
SynonymsGA_x6K02T2RE5P-2573738-2574676, MOR214-5
MMRRC Submission 039536-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1483 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12200634-12212191 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 12209750 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 61 (Y61*)
Ref Sequence ENSEMBL: ENSMUSP00000150967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072316] [ENSMUST00000213759]
Predicted Effect probably null
Transcript: ENSMUST00000072316
AA Change: Y61*
SMART Domains Protein: ENSMUSP00000072158
Gene: ENSMUSG00000094133
AA Change: Y61*

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 8.4e-56 PFAM
Pfam:7tm_1 42 309 2.4e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213759
AA Change: Y61*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214138
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,903 S368T probably damaging Het
9930021J03Rik G A 19: 29,719,345 P916L possibly damaging Het
Adam12 T A 7: 133,930,025 T494S probably benign Het
Akap6 C T 12: 52,796,087 P73S probably damaging Het
Amotl2 A T 9: 102,730,897 T763S probably benign Het
C87499 T A 4: 88,628,834 Q116L probably damaging Het
Cdc5l A T 17: 45,408,364 V541D possibly damaging Het
Chl1 A G 6: 103,647,287 Y52C probably damaging Het
D6Wsu163e A G 6: 126,954,770 E255G probably benign Het
Ddhd2 A G 8: 25,753,128 S126P probably benign Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Drc3 A G 11: 60,388,889 I427V probably benign Het
Drg2 T C 11: 60,459,527 I104T probably damaging Het
Dst C T 1: 34,252,998 A932V probably damaging Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Eif3a A T 19: 60,768,726 D880E unknown Het
Elf1 T A 14: 79,580,638 D569E probably benign Het
Esp6 T A 17: 40,562,925 M1K probably null Het
Fer1l6 T C 15: 58,637,970 V1427A possibly damaging Het
Gm17689 G A 9: 36,581,324 S95L probably benign Het
Gsta1 A T 9: 78,242,493 K196M probably damaging Het
Gzme T A 14: 56,118,712 I110F probably damaging Het
H2-DMa T A 17: 34,135,750 V27E possibly damaging Het
H2-T10 A T 17: 36,121,146 S2T probably benign Het
Hadhb A G 5: 30,169,494 probably null Het
Hoxa11 G T 6: 52,243,456 D282E probably damaging Het
Ifit1bl1 A G 19: 34,594,641 Y139H possibly damaging Het
Ift27 A G 15: 78,165,236 V88A possibly damaging Het
Knop1 C T 7: 118,853,050 A149T probably damaging Het
Macf1 T A 4: 123,510,977 K597I probably damaging Het
Med16 A T 10: 79,903,100 I284N possibly damaging Het
Melk T A 4: 44,308,937 I98K probably damaging Het
Mst1 G T 9: 108,081,650 G127V probably benign Het
Nacad A G 11: 6,602,217 S325P probably damaging Het
Nbea G A 3: 56,002,790 P1328L probably benign Het
Nek5 C T 8: 22,096,790 S335N probably benign Het
Nif3l1 C A 1: 58,447,726 R24S probably benign Het
Nlrp14 T G 7: 107,190,122 N39K possibly damaging Het
Nup50 T A 15: 84,939,727 V427D probably damaging Het
Nwd1 C T 8: 72,657,086 P78L probably damaging Het
Pnkd A G 1: 74,349,391 Y242C probably benign Het
Ppm1g T C 5: 31,203,121 D423G probably benign Het
Prkci A T 3: 31,043,792 N464Y probably damaging Het
Ptprf C T 4: 118,235,964 V494M possibly damaging Het
Rapgef4 T G 2: 72,055,026 probably null Het
Rbak T C 5: 143,174,344 E318G probably damaging Het
Rora A G 9: 69,364,385 D215G probably benign Het
Rp1l1 C T 14: 64,029,047 T694I possibly damaging Het
Scrib A G 15: 76,057,922 L1032P probably damaging Het
Sectm1b G A 11: 121,055,826 T81M probably benign Het
Sgk3 T C 1: 9,872,293 F97L possibly damaging Het
Socs3 A T 11: 117,967,568 Y221* probably null Het
Tdrd6 T A 17: 43,627,607 H850L probably benign Het
Tex44 G T 1: 86,427,186 Q272H probably damaging Het
Tgfbr2 A C 9: 116,109,557 S426A probably benign Het
Tmem39b T C 4: 129,676,663 Y461C probably damaging Het
Ttn T A 2: 76,724,993 D30556V probably damaging Het
Tubgcp5 T A 7: 55,825,707 probably null Het
Vmn2r70 T C 7: 85,559,167 I701V probably benign Het
Vps39 A T 2: 120,323,648 L622Q probably damaging Het
Wdfy4 T A 14: 33,100,966 H1347L probably benign Het
Xpo1 A G 11: 23,284,863 I540V probably benign Het
Xylt2 A C 11: 94,669,567 M294R probably benign Het
Zfp788 T G 7: 41,649,075 Y326* probably null Het
Zim1 A G 7: 6,682,125 F109L probably benign Het
Other mutations in Olfr1431
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Olfr1431 APN 19 12210040 missense possibly damaging 0.65
IGL02206:Olfr1431 APN 19 12210460 missense probably damaging 1.00
IGL02938:Olfr1431 APN 19 12209682 missense probably benign 0.00
PIT4812001:Olfr1431 UTSW 19 12210253 missense probably damaging 1.00
R0402:Olfr1431 UTSW 19 12209589 missense probably damaging 1.00
R0661:Olfr1431 UTSW 19 12209704 missense probably damaging 1.00
R1193:Olfr1431 UTSW 19 12210439 missense probably damaging 1.00
R4091:Olfr1431 UTSW 19 12209779 missense probably damaging 1.00
R4280:Olfr1431 UTSW 19 12209938 missense probably damaging 1.00
R5028:Olfr1431 UTSW 19 12210154 missense possibly damaging 0.94
R5540:Olfr1431 UTSW 19 12210460 missense probably damaging 1.00
R6042:Olfr1431 UTSW 19 12209922 missense probably damaging 0.99
R6045:Olfr1431 UTSW 19 12210295 missense probably damaging 1.00
R7104:Olfr1431 UTSW 19 12209878 missense possibly damaging 0.82
Z1088:Olfr1431 UTSW 19 12210490 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTGGCATCAAGGAACTACCTGCTTC -3'
(R):5'- GGCAACATTCAGTCAGCCCCATAG -3'

Sequencing Primer
(F):5'- TGTCACTAGAGTCAGCAATGC -3'
(R):5'- CAGTCAGCCCCATAGTGGAAAG -3'
Posted On2014-03-28