Incidental Mutation 'R1470:Mapkbp1'
ID 165765
Institutional Source Beutler Lab
Gene Symbol Mapkbp1
Ensembl Gene ENSMUSG00000033902
Gene Name mitogen-activated protein kinase binding protein 1
Synonyms 2810483F24Rik, Jnkbp1
MMRRC Submission 039523-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1470 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 119803180-119857889 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119848301 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 617 (M617T)
Ref Sequence ENSEMBL: ENSMUSP00000068516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066058] [ENSMUST00000229024]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000066058
AA Change: M617T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068516
Gene: ENSMUSG00000033902
AA Change: M617T

DomainStartEndE-ValueType
WD40 80 121 8.75e-5 SMART
WD40 124 165 3.64e-2 SMART
WD40 168 205 4.62e-1 SMART
low complexity region 220 234 N/A INTRINSIC
WD40 264 301 2.65e1 SMART
WD40 332 367 1.99e0 SMART
WD40 374 422 1.29e-2 SMART
WD40 463 502 3.9e-2 SMART
WD40 505 547 2.77e-1 SMART
WD40 551 592 2.67e-1 SMART
WD40 599 639 2.21e1 SMART
WD40 642 684 5.75e-1 SMART
WD40 687 726 6.04e-8 SMART
low complexity region 736 747 N/A INTRINSIC
low complexity region 779 795 N/A INTRINSIC
low complexity region 1028 1054 N/A INTRINSIC
coiled coil region 1400 1427 N/A INTRINSIC
low complexity region 1460 1477 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184907
Predicted Effect possibly damaging
Transcript: ENSMUST00000229024
AA Change: M623T

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
Meta Mutation Damage Score 0.6389 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.4%
  • 10x: 90.6%
  • 20x: 68.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,944,337 (GRCm39) S749T unknown Het
Abcb4 A T 5: 8,990,968 (GRCm39) I843F probably damaging Het
Actr8 T A 14: 29,708,926 (GRCm39) H244Q possibly damaging Het
Adgrv1 A G 13: 81,530,417 (GRCm39) Y5886H probably benign Het
Agk T A 6: 40,363,751 (GRCm39) W244R probably damaging Het
Ankrd11 C A 8: 123,626,463 (GRCm39) V161L probably damaging Het
Arap3 T C 18: 38,122,249 (GRCm39) probably null Het
Armc3 A G 2: 19,243,547 (GRCm39) M88V probably benign Het
Atp13a5 G T 16: 29,167,833 (GRCm39) P109T probably benign Het
Avpr1b T A 1: 131,528,323 (GRCm39) V282D probably damaging Het
Baz2b T C 2: 59,808,890 (GRCm39) K120E possibly damaging Het
Bltp1 T C 3: 37,052,480 (GRCm39) M3060T probably benign Het
Cacng6 G A 7: 3,473,404 (GRCm39) C76Y probably damaging Het
Cactin G T 10: 81,158,985 (GRCm39) E279* probably null Het
Car9 A G 4: 43,510,222 (GRCm39) Y268C probably damaging Het
Ccdc146 T A 5: 21,524,564 (GRCm39) I263F probably damaging Het
Cdh16 T G 8: 105,345,003 (GRCm39) S429R probably benign Het
Cep250 A G 2: 155,832,995 (GRCm39) E1639G probably damaging Het
Ces1d A T 8: 93,921,649 (GRCm39) V38D possibly damaging Het
Chd1 A T 17: 15,946,545 (GRCm39) Q97L possibly damaging Het
Ciita G A 16: 10,332,332 (GRCm39) D898N possibly damaging Het
Clstn1 A G 4: 149,719,179 (GRCm39) N336S possibly damaging Het
Cntnap5a A G 1: 116,187,249 (GRCm39) D607G probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Col20a1 C T 2: 180,636,753 (GRCm39) H245Y probably benign Het
Coq8b A T 7: 26,951,734 (GRCm39) T399S probably benign Het
Cpn2 A G 16: 30,079,003 (GRCm39) S233P probably benign Het
Cryz G A 3: 154,312,113 (GRCm39) G70D probably damaging Het
Def6 T A 17: 28,444,956 (GRCm39) D451E possibly damaging Het
Dnah8 T A 17: 30,966,251 (GRCm39) C2480* probably null Het
Dnah9 T C 11: 65,818,648 (GRCm39) N3230S probably benign Het
Dyrk4 G T 6: 126,893,337 (GRCm39) S15* probably null Het
Erc1 T C 6: 119,671,563 (GRCm39) R917G probably damaging Het
Frem3 G T 8: 81,337,820 (GRCm39) V38L probably benign Het
Gas2l3 T C 10: 89,249,796 (GRCm39) I441V probably benign Het
Gm14393 T A 2: 174,905,774 (GRCm39) Y6F probably damaging Het
Gm1527 A G 3: 28,969,417 (GRCm39) K256E possibly damaging Het
Gm21905 G T 5: 68,103,740 (GRCm39) probably benign Het
Gtf2ird1 T A 5: 134,424,656 (GRCm39) probably null Het
Hmces C A 6: 87,913,121 (GRCm39) T292K probably benign Het
Hpse2 G A 19: 43,376,692 (GRCm39) S20L probably benign Het
Ift70b G T 2: 75,768,155 (GRCm39) S199R probably benign Het
Ikbke A T 1: 131,204,224 (GRCm39) V23E probably null Het
Ino80 A T 2: 119,210,130 (GRCm39) V1387E probably damaging Het
Islr G T 9: 58,064,589 (GRCm39) A306D probably damaging Het
Jakmip1 G A 5: 37,258,182 (GRCm39) G276D probably damaging Het
Jchain A G 5: 88,673,979 (GRCm39) V55A probably benign Het
Kalrn T C 16: 34,007,841 (GRCm39) K1350E probably damaging Het
Kansl1l T C 1: 66,841,156 (GRCm39) Q48R possibly damaging Het
Kmt5a T C 5: 124,585,334 (GRCm39) L23P probably damaging Het
Lrba C T 3: 86,644,449 (GRCm39) H381Y probably damaging Het
Lrrc32 T C 7: 98,148,564 (GRCm39) V448A probably benign Het
Mfap1a T C 2: 121,333,282 (GRCm39) M50V probably benign Het
Mgam G T 6: 40,736,062 (GRCm39) A854S probably damaging Het
Myo18b C A 5: 112,840,899 (GRCm39) R2298L probably damaging Het
Myo1h T A 5: 114,457,765 (GRCm39) M92K probably damaging Het
Nlrp2 T A 7: 5,303,950 (GRCm39) T192S probably benign Het
Nr2f1 A T 13: 78,346,284 (GRCm39) Y137N possibly damaging Het
Nup98 T A 7: 101,796,513 (GRCm39) D841V probably damaging Het
Nvl A G 1: 180,966,827 (GRCm39) V59A probably damaging Het
Ogdhl C A 14: 32,068,745 (GRCm39) N948K probably damaging Het
Or11g27 T C 14: 50,771,159 (GRCm39) S97P possibly damaging Het
Or12j3 A G 7: 139,953,026 (GRCm39) S166P probably benign Het
Or13a24 A G 7: 140,154,662 (GRCm39) T199A probably benign Het
Or51g1 A C 7: 102,633,530 (GRCm39) Y280* probably null Het
Osgin1 G A 8: 120,171,704 (GRCm39) R166H probably damaging Het
Palb2 A T 7: 121,706,746 (GRCm39) F741I probably benign Het
Palb2 G T 7: 121,706,747 (GRCm39) Y740* probably null Het
Parvb G A 15: 84,155,509 (GRCm39) D65N probably benign Het
Parvb G A 15: 84,155,453 (GRCm39) G46D probably damaging Het
Pcsk2 A T 2: 143,388,438 (GRCm39) K10* probably null Het
Pde3a C T 6: 141,411,932 (GRCm39) A502V probably benign Het
Pfas T C 11: 68,882,185 (GRCm39) I893V probably benign Het
Pla2g4a A T 1: 149,716,471 (GRCm39) D663E probably damaging Het
Prickle2 G A 6: 92,435,583 (GRCm39) P6L probably damaging Het
Prx T A 7: 27,217,026 (GRCm39) M648K probably benign Het
Ptpn21 T C 12: 98,654,735 (GRCm39) N744S probably benign Het
Ptprq C T 10: 107,554,435 (GRCm39) V97M probably damaging Het
Pvr T C 7: 19,652,549 (GRCm39) E122G possibly damaging Het
Racgap1 T C 15: 99,537,656 (GRCm39) K15E probably damaging Het
Rock1 C T 18: 10,136,091 (GRCm39) probably null Het
Rorc T A 3: 94,304,609 (GRCm39) Y331* probably null Het
Rpl37 T C 15: 5,148,096 (GRCm39) V91A probably benign Het
Rrp36 T A 17: 46,983,306 (GRCm39) K103* probably null Het
Ryr3 T A 2: 112,483,352 (GRCm39) M4142L probably benign Het
Sash1 A T 10: 8,665,357 (GRCm39) L125H probably damaging Het
Scn5a T C 9: 119,365,541 (GRCm39) M369V possibly damaging Het
Sfi1 TCGC TC 11: 3,096,254 (GRCm39) probably null Het
Sfi1 C CT 11: 3,096,255 (GRCm39) probably null Het
Siglec1 A T 2: 130,912,307 (GRCm39) N1678K probably benign Het
Slc15a5 A T 6: 138,049,992 (GRCm39) V141E probably benign Het
Slc8a3 A T 12: 81,246,484 (GRCm39) H856Q probably benign Het
Sptlc2 T A 12: 87,402,414 (GRCm39) M171L probably benign Het
Srcap T A 7: 127,158,899 (GRCm39) probably benign Het
St6gal2 A G 17: 55,797,944 (GRCm39) D310G probably damaging Het
Susd2 T A 10: 75,473,888 (GRCm39) D689V probably damaging Het
Suz12 A T 11: 79,910,558 (GRCm39) E303V possibly damaging Het
Taldo1 C A 7: 140,978,500 (GRCm39) T150K probably damaging Het
Tg T A 15: 66,721,312 (GRCm39) F274I possibly damaging Het
Tmem151b T C 17: 45,856,663 (GRCm39) D259G probably damaging Het
Tmem179 G T 12: 112,468,288 (GRCm39) H64Q probably benign Het
Tmem236 A G 2: 14,223,732 (GRCm39) T174A probably benign Het
Tnc A T 4: 63,884,811 (GRCm39) N1821K probably damaging Het
Tnfrsf11a A G 1: 105,752,773 (GRCm39) N261S probably damaging Het
Trank1 C A 9: 111,172,300 (GRCm39) F96L possibly damaging Het
Trim56 T A 5: 137,142,017 (GRCm39) I500F probably damaging Het
Ttll5 A G 12: 85,926,168 (GRCm39) I321V possibly damaging Het
Ttn C A 2: 76,608,367 (GRCm39) W17852L probably damaging Het
Twnk G A 19: 44,997,820 (GRCm39) V450M probably damaging Het
Uba52 A G 8: 70,962,206 (GRCm39) I127T possibly damaging Het
Ubr4 T A 4: 139,148,537 (GRCm39) probably null Het
Uggt1 A T 1: 36,215,877 (GRCm39) M130K probably benign Het
Ulk4 T A 9: 120,910,722 (GRCm39) T1101S probably benign Het
Urb1 A G 16: 90,548,902 (GRCm39) S2269P probably benign Het
Ush2a G T 1: 188,132,403 (GRCm39) R875L probably benign Het
Usp9y T A Y: 1,332,471 (GRCm39) H1624L probably benign Het
Vipr1 T C 9: 121,494,586 (GRCm39) L308S possibly damaging Het
Xdh T G 17: 74,198,107 (GRCm39) K1260T probably damaging Het
Yipf4 A G 17: 74,800,963 (GRCm39) I94V probably benign Het
Zfhx4 A G 3: 5,478,206 (GRCm39) *3582W probably null Het
Zfp58 T C 13: 67,640,144 (GRCm39) N116D possibly damaging Het
Zfp750 C A 11: 121,402,819 (GRCm39) R643L probably benign Het
Znfx1 A G 2: 166,884,507 (GRCm39) V51A possibly damaging Het
Other mutations in Mapkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Mapkbp1 APN 2 119,852,339 (GRCm39) missense possibly damaging 0.94
IGL01309:Mapkbp1 APN 2 119,849,423 (GRCm39) missense probably damaging 1.00
IGL01728:Mapkbp1 APN 2 119,854,302 (GRCm39) missense probably damaging 1.00
IGL01808:Mapkbp1 APN 2 119,853,650 (GRCm39) splice site probably null
IGL02185:Mapkbp1 APN 2 119,845,144 (GRCm39) missense possibly damaging 0.58
IGL02421:Mapkbp1 APN 2 119,850,136 (GRCm39) missense possibly damaging 0.95
IGL02691:Mapkbp1 APN 2 119,803,655 (GRCm39) splice site probably benign
IGL03146:Mapkbp1 APN 2 119,828,955 (GRCm39) splice site probably benign
IGL03387:Mapkbp1 APN 2 119,828,979 (GRCm39) missense probably damaging 0.99
IGL03054:Mapkbp1 UTSW 2 119,845,881 (GRCm39) missense probably damaging 0.97
R0118:Mapkbp1 UTSW 2 119,855,696 (GRCm39) missense probably benign 0.00
R0393:Mapkbp1 UTSW 2 119,843,384 (GRCm39) splice site probably null
R0463:Mapkbp1 UTSW 2 119,853,632 (GRCm39) missense probably benign 0.01
R0788:Mapkbp1 UTSW 2 119,854,482 (GRCm39) missense probably benign 0.02
R0928:Mapkbp1 UTSW 2 119,845,849 (GRCm39) missense probably benign 0.00
R1104:Mapkbp1 UTSW 2 119,841,554 (GRCm39) splice site probably benign
R1162:Mapkbp1 UTSW 2 119,855,799 (GRCm39) missense possibly damaging 0.87
R1219:Mapkbp1 UTSW 2 119,849,831 (GRCm39) nonsense probably null
R1299:Mapkbp1 UTSW 2 119,845,885 (GRCm39) missense probably damaging 1.00
R1300:Mapkbp1 UTSW 2 119,844,136 (GRCm39) missense probably benign 0.25
R1342:Mapkbp1 UTSW 2 119,829,015 (GRCm39) missense possibly damaging 0.95
R1456:Mapkbp1 UTSW 2 119,803,626 (GRCm39) missense probably damaging 1.00
R1464:Mapkbp1 UTSW 2 119,851,742 (GRCm39) missense probably benign
R1464:Mapkbp1 UTSW 2 119,851,742 (GRCm39) missense probably benign
R1470:Mapkbp1 UTSW 2 119,848,301 (GRCm39) missense probably damaging 1.00
R1660:Mapkbp1 UTSW 2 119,849,029 (GRCm39) missense possibly damaging 0.83
R2008:Mapkbp1 UTSW 2 119,843,146 (GRCm39) missense probably damaging 1.00
R2083:Mapkbp1 UTSW 2 119,845,963 (GRCm39) missense possibly damaging 0.96
R2371:Mapkbp1 UTSW 2 119,841,261 (GRCm39) missense probably damaging 1.00
R2423:Mapkbp1 UTSW 2 119,855,071 (GRCm39) missense probably benign 0.00
R3976:Mapkbp1 UTSW 2 119,852,339 (GRCm39) missense possibly damaging 0.94
R4009:Mapkbp1 UTSW 2 119,854,086 (GRCm39) missense probably benign 0.00
R4183:Mapkbp1 UTSW 2 119,848,346 (GRCm39) missense probably damaging 1.00
R4246:Mapkbp1 UTSW 2 119,843,508 (GRCm39) missense probably damaging 1.00
R4503:Mapkbp1 UTSW 2 119,846,187 (GRCm39) missense probably damaging 1.00
R4513:Mapkbp1 UTSW 2 119,854,174 (GRCm39) missense possibly damaging 0.63
R4517:Mapkbp1 UTSW 2 119,855,545 (GRCm39) intron probably benign
R4742:Mapkbp1 UTSW 2 119,847,299 (GRCm39) missense probably damaging 1.00
R5049:Mapkbp1 UTSW 2 119,845,982 (GRCm39) splice site probably benign
R5079:Mapkbp1 UTSW 2 119,844,214 (GRCm39) missense probably damaging 0.99
R5137:Mapkbp1 UTSW 2 119,852,662 (GRCm39) missense probably damaging 1.00
R5255:Mapkbp1 UTSW 2 119,847,735 (GRCm39) missense probably damaging 1.00
R5530:Mapkbp1 UTSW 2 119,845,836 (GRCm39) missense probably benign
R5546:Mapkbp1 UTSW 2 119,849,724 (GRCm39) missense probably damaging 1.00
R5634:Mapkbp1 UTSW 2 119,803,576 (GRCm39) missense probably damaging 1.00
R5696:Mapkbp1 UTSW 2 119,852,201 (GRCm39) splice site probably null
R5891:Mapkbp1 UTSW 2 119,854,413 (GRCm39) nonsense probably null
R6263:Mapkbp1 UTSW 2 119,853,772 (GRCm39) missense probably damaging 1.00
R6807:Mapkbp1 UTSW 2 119,851,640 (GRCm39) missense probably damaging 0.99
R6890:Mapkbp1 UTSW 2 119,846,283 (GRCm39) missense probably damaging 1.00
R7159:Mapkbp1 UTSW 2 119,855,613 (GRCm39) missense possibly damaging 0.72
R7467:Mapkbp1 UTSW 2 119,852,669 (GRCm39) missense probably damaging 1.00
R7536:Mapkbp1 UTSW 2 119,849,066 (GRCm39) missense probably damaging 1.00
R7564:Mapkbp1 UTSW 2 119,844,232 (GRCm39) missense probably benign 0.09
R7801:Mapkbp1 UTSW 2 119,842,554 (GRCm39) missense probably damaging 1.00
R7886:Mapkbp1 UTSW 2 119,843,128 (GRCm39) missense possibly damaging 0.90
R8095:Mapkbp1 UTSW 2 119,848,131 (GRCm39) missense probably benign 0.11
R8421:Mapkbp1 UTSW 2 119,849,431 (GRCm39) missense probably damaging 0.99
R8548:Mapkbp1 UTSW 2 119,854,572 (GRCm39) missense probably benign 0.33
R8856:Mapkbp1 UTSW 2 119,845,109 (GRCm39) missense probably damaging 1.00
R8971:Mapkbp1 UTSW 2 119,850,050 (GRCm39) missense probably benign
R9007:Mapkbp1 UTSW 2 119,850,143 (GRCm39) missense probably damaging 0.99
R9251:Mapkbp1 UTSW 2 119,853,671 (GRCm39) missense probably benign 0.00
R9255:Mapkbp1 UTSW 2 119,843,556 (GRCm39) missense probably damaging 1.00
R9361:Mapkbp1 UTSW 2 119,845,252 (GRCm39) missense probably benign 0.02
R9587:Mapkbp1 UTSW 2 119,847,277 (GRCm39) missense possibly damaging 0.80
R9685:Mapkbp1 UTSW 2 119,851,664 (GRCm39) missense probably benign 0.35
R9803:Mapkbp1 UTSW 2 119,841,256 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACTTCCGAACTGCACAGAAGGTAAG -3'
(R):5'- TCAAAGAGGCTCGAAAGCCTGGAC -3'

Sequencing Primer
(F):5'- TGCACAGAAGGTAAGGGCAC -3'
(R):5'- ttgctgcctggactgatg -3'
Posted On 2014-03-28