Incidental Mutation 'R1470:Abcb4'
ID165785
Institutional Source Beutler Lab
Gene Symbol Abcb4
Ensembl Gene ENSMUSG00000042476
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 4
SynonymsPgy-2, Mdr2, Pgy2, mdr-2
MMRRC Submission 039523-MU
Accession Numbers

Ncbi RefSeq: NM_008830; MGI: 97569

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1470 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8893717-8959231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8940968 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 843 (I843F)
Ref Sequence ENSEMBL: ENSMUSP00000142425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003717] [ENSMUST00000196067]
Predicted Effect probably damaging
Transcript: ENSMUST00000003717
AA Change: I843F

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003717
Gene: ENSMUSG00000042476
AA Change: I843F

DomainStartEndE-ValueType
Pfam:ABC_membrane 54 342 2e-94 PFAM
AAA 418 610 3.97e-20 SMART
Pfam:ABC_membrane 708 982 6.3e-77 PFAM
AAA 1058 1246 4.49e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196067
AA Change: I843F

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142425
Gene: ENSMUSG00000042476
AA Change: I843F

DomainStartEndE-ValueType
Pfam:ABC_membrane 54 344 2.4e-95 PFAM
AAA 418 610 6.2e-22 SMART
Pfam:ABC_membrane 708 882 1.6e-37 PFAM
Meta Mutation Damage Score 0.3483 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.4%
  • 10x: 90.6%
  • 20x: 68.6%
Validation Efficiency
MGI Phenotype Strain: 1857236
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are unable to secrete phospholipids into bile, leading to progressive hepatic disease, with an end stage of 3 months. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,998,331 M3060T probably benign Het
Aak1 T A 6: 86,967,355 S749T unknown Het
Actr8 T A 14: 29,986,969 H244Q possibly damaging Het
Adgrv1 A G 13: 81,382,298 Y5886H probably benign Het
Agk T A 6: 40,386,817 W244R probably damaging Het
Ankrd11 C A 8: 122,899,724 V161L probably damaging Het
Arap3 T C 18: 37,989,196 probably null Het
Armc3 A G 2: 19,238,736 M88V probably benign Het
Atp13a5 G T 16: 29,349,015 P109T probably benign Het
Avpr1b T A 1: 131,600,585 V282D probably damaging Het
Baz2b T C 2: 59,978,546 K120E possibly damaging Het
Cacng6 G A 7: 3,424,888 C76Y probably damaging Het
Cactin G T 10: 81,323,151 E279* probably null Het
Car9 A G 4: 43,510,222 Y268C probably damaging Het
Ccdc146 T A 5: 21,319,566 I263F probably damaging Het
Cdh16 T G 8: 104,618,371 S429R probably benign Het
Cep250 A G 2: 155,991,075 E1639G probably damaging Het
Ces1d A T 8: 93,195,021 V38D possibly damaging Het
Chd1 A T 17: 15,726,283 Q97L possibly damaging Het
Ciita G A 16: 10,514,468 D898N possibly damaging Het
Clstn1 A G 4: 149,634,722 N336S possibly damaging Het
Cntnap5a A G 1: 116,259,519 D607G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col20a1 C T 2: 180,994,960 H245Y probably benign Het
Coq8b A T 7: 27,252,309 T399S probably benign Het
Cpn2 A G 16: 30,260,185 S233P probably benign Het
Cryz G A 3: 154,606,476 G70D probably damaging Het
Def6 T A 17: 28,225,982 D451E possibly damaging Het
Dnah8 T A 17: 30,747,277 C2480* probably null Het
Dnah9 T C 11: 65,927,822 N3230S probably benign Het
Dyrk4 G T 6: 126,916,374 S15* probably null Het
Erc1 T C 6: 119,694,602 R917G probably damaging Het
Frem3 G T 8: 80,611,191 V38L probably benign Het
Gas2l3 T C 10: 89,413,934 I441V probably benign Het
Gm14393 T A 2: 175,063,981 Y6F probably damaging Het
Gm1527 A G 3: 28,915,268 K256E possibly damaging Het
Gm21905 G T 5: 67,946,397 probably benign Het
Gtf2ird1 T A 5: 134,395,802 probably null Het
Hmces C A 6: 87,936,139 T292K probably benign Het
Hpse2 G A 19: 43,388,253 S20L probably benign Het
Ikbke A T 1: 131,276,487 V23E probably null Het
Ino80 A T 2: 119,379,649 V1387E probably damaging Het
Islr G T 9: 58,157,306 A306D probably damaging Het
Jakmip1 G A 5: 37,100,838 G276D probably damaging Het
Jchain A G 5: 88,526,120 V55A probably benign Het
Kalrn T C 16: 34,187,471 K1350E probably damaging Het
Kansl1l T C 1: 66,801,997 Q48R possibly damaging Het
Kmt5a T C 5: 124,447,271 L23P probably damaging Het
Lrba C T 3: 86,737,142 H381Y probably damaging Het
Lrrc32 T C 7: 98,499,357 V448A probably benign Het
Mapkbp1 T C 2: 120,017,820 M617T probably damaging Het
Mfap1a T C 2: 121,502,801 M50V probably benign Het
Mgam G T 6: 40,759,128 A854S probably damaging Het
Myo18b C A 5: 112,693,033 R2298L probably damaging Het
Myo1h T A 5: 114,319,704 M92K probably damaging Het
Nlrp2 T A 7: 5,300,951 T192S probably benign Het
Nr2f1 A T 13: 78,198,165 Y137N possibly damaging Het
Nup98 T A 7: 102,147,306 D841V probably damaging Het
Nvl A G 1: 181,139,262 V59A probably damaging Het
Ogdhl C A 14: 32,346,788 N948K probably damaging Het
Olfr530 A G 7: 140,373,113 S166P probably benign Het
Olfr538 A G 7: 140,574,749 T199A probably benign Het
Olfr578 A C 7: 102,984,323 Y280* probably null Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Osgin1 G A 8: 119,444,965 R166H probably damaging Het
Palb2 A T 7: 122,107,523 F741I probably benign Het
Palb2 G T 7: 122,107,524 Y740* probably null Het
Parvb G A 15: 84,271,308 D65N probably benign Het
Parvb G A 15: 84,271,252 G46D probably damaging Het
Pcsk2 A T 2: 143,546,518 K10* probably null Het
Pde3a C T 6: 141,466,206 A502V probably benign Het
Pfas T C 11: 68,991,359 I893V probably benign Het
Pla2g4a A T 1: 149,840,720 D663E probably damaging Het
Prickle2 G A 6: 92,458,602 P6L probably damaging Het
Prx T A 7: 27,517,601 M648K probably benign Het
Ptpn21 T C 12: 98,688,476 N744S probably benign Het
Ptprq C T 10: 107,718,574 V97M probably damaging Het
Pvr T C 7: 19,918,624 E122G possibly damaging Het
Racgap1 T C 15: 99,639,775 K15E probably damaging Het
Rock1 C T 18: 10,136,091 probably null Het
Rorc T A 3: 94,397,302 Y331* probably null Het
Rpl37 T C 15: 5,118,614 V91A probably benign Het
Rrp36 T A 17: 46,672,380 K103* probably null Het
Ryr3 T A 2: 112,653,007 M4142L probably benign Het
Sash1 A T 10: 8,789,593 L125H probably damaging Het
Scn5a T C 9: 119,536,475 M369V possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 C CT 11: 3,146,255 probably null Het
Siglec1 A T 2: 131,070,387 N1678K probably benign Het
Slc15a5 A T 6: 138,072,994 V141E probably benign Het
Slc8a3 A T 12: 81,199,710 H856Q probably benign Het
Sptlc2 T A 12: 87,355,640 M171L probably benign Het
Srcap T A 7: 127,559,727 probably benign Het
St6gal2 A G 17: 55,490,943 D310G probably damaging Het
Susd2 T A 10: 75,638,054 D689V probably damaging Het
Suz12 A T 11: 80,019,732 E303V possibly damaging Het
Taldo1 C A 7: 141,398,587 T150K probably damaging Het
Tg T A 15: 66,849,463 F274I possibly damaging Het
Tmem151b T C 17: 45,545,737 D259G probably damaging Het
Tmem179 G T 12: 112,501,854 H64Q probably benign Het
Tmem236 A G 2: 14,218,921 T174A probably benign Het
Tnc A T 4: 63,966,574 N1821K probably damaging Het
Tnfrsf11a A G 1: 105,825,048 N261S probably damaging Het
Trank1 C A 9: 111,343,232 F96L possibly damaging Het
Trim56 T A 5: 137,113,163 I500F probably damaging Het
Ttc30b G T 2: 75,937,811 S199R probably benign Het
Ttll5 A G 12: 85,879,394 I321V possibly damaging Het
Ttn C A 2: 76,778,023 W17852L probably damaging Het
Twnk G A 19: 45,009,381 V450M probably damaging Het
Uba52 A G 8: 70,509,556 I127T possibly damaging Het
Ubr4 T A 4: 139,421,226 probably null Het
Uggt1 A T 1: 36,176,796 M130K probably benign Het
Ulk4 T A 9: 121,081,656 T1101S probably benign Het
Urb1 A G 16: 90,752,014 S2269P probably benign Het
Ush2a G T 1: 188,400,206 R875L probably benign Het
Usp9y T A Y: 1,332,471 H1624L probably benign Het
Vipr1 T C 9: 121,665,520 L308S possibly damaging Het
Xdh T G 17: 73,891,112 K1260T probably damaging Het
Yipf4 A G 17: 74,493,968 I94V probably benign Het
Zfhx4 A G 3: 5,413,146 *3582W probably null Het
Zfp58 T C 13: 67,492,025 N116D possibly damaging Het
Zfp750 C A 11: 121,511,993 R643L probably benign Het
Znfx1 A G 2: 167,042,587 V51A possibly damaging Het
Other mutations in Abcb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Abcb4 APN 5 8950073 missense probably benign 0.02
IGL00663:Abcb4 APN 5 8927916 missense probably damaging 1.00
IGL00671:Abcb4 APN 5 8930745 nonsense probably null
IGL00822:Abcb4 APN 5 8950046 missense probably benign
IGL01080:Abcb4 APN 5 8934258 missense probably damaging 1.00
IGL01152:Abcb4 APN 5 8950678 missense probably benign 0.19
IGL01329:Abcb4 APN 5 8894166 critical splice donor site probably null
IGL01483:Abcb4 APN 5 8927871 missense probably damaging 0.99
IGL01594:Abcb4 APN 5 8946071 unclassified probably null
IGL01785:Abcb4 APN 5 8915058 nonsense probably null
IGL01968:Abcb4 APN 5 8927913 missense probably benign 0.33
IGL02579:Abcb4 APN 5 8955537 missense probably damaging 1.00
IGL02654:Abcb4 APN 5 8927826 missense possibly damaging 0.80
IGL02658:Abcb4 APN 5 8934240 missense probably benign
IGL03229:Abcb4 APN 5 8940936 missense probably damaging 0.97
IGL03335:Abcb4 APN 5 8935258 missense probably benign 0.00
FR4737:Abcb4 UTSW 5 8896597 small deletion probably benign
P0014:Abcb4 UTSW 5 8950083 missense probably benign 0.01
R0102:Abcb4 UTSW 5 8909194 missense probably damaging 0.99
R0102:Abcb4 UTSW 5 8909194 missense probably damaging 0.99
R0309:Abcb4 UTSW 5 8939835 missense probably damaging 1.00
R0311:Abcb4 UTSW 5 8934243 missense probably benign
R0420:Abcb4 UTSW 5 8941050 missense probably benign 0.03
R0449:Abcb4 UTSW 5 8939885 nonsense probably null
R0609:Abcb4 UTSW 5 8947376 missense probably damaging 0.96
R1459:Abcb4 UTSW 5 8918662 missense possibly damaging 0.61
R1470:Abcb4 UTSW 5 8940968 missense probably damaging 0.98
R1812:Abcb4 UTSW 5 8928578 critical splice donor site probably null
R1944:Abcb4 UTSW 5 8930796 missense probably damaging 1.00
R2002:Abcb4 UTSW 5 8905989 missense probably benign 0.01
R2256:Abcb4 UTSW 5 8958431 missense probably damaging 1.00
R3116:Abcb4 UTSW 5 8896610 missense possibly damaging 0.86
R4112:Abcb4 UTSW 5 8936783 critical splice acceptor site probably null
R4354:Abcb4 UTSW 5 8918771 missense probably benign 0.44
R4512:Abcb4 UTSW 5 8928573 missense probably damaging 1.00
R4588:Abcb4 UTSW 5 8947328 missense probably benign 0.01
R4628:Abcb4 UTSW 5 8907399 missense probably benign 0.08
R4708:Abcb4 UTSW 5 8915125 missense possibly damaging 0.90
R4714:Abcb4 UTSW 5 8930906 splice site probably null
R4754:Abcb4 UTSW 5 8910717 missense probably damaging 1.00
R4846:Abcb4 UTSW 5 8935180 missense probably benign
R4896:Abcb4 UTSW 5 8907267 missense possibly damaging 0.81
R4944:Abcb4 UTSW 5 8934327 critical splice donor site probably null
R4994:Abcb4 UTSW 5 8928524 missense probably damaging 1.00
R5022:Abcb4 UTSW 5 8909054 intron probably null
R5537:Abcb4 UTSW 5 8955485 missense probably damaging 0.98
R5754:Abcb4 UTSW 5 8934320 missense probably benign
R5833:Abcb4 UTSW 5 8958314 missense probably damaging 1.00
R5934:Abcb4 UTSW 5 8930806 missense probably benign 0.18
R6006:Abcb4 UTSW 5 8946026 missense probably damaging 0.99
R6146:Abcb4 UTSW 5 8896587 missense probably benign 0.05
R6183:Abcb4 UTSW 5 8918718 missense probably benign
R6260:Abcb4 UTSW 5 8934219 nonsense probably null
R6561:Abcb4 UTSW 5 8927825 missense probably benign 0.14
R7016:Abcb4 UTSW 5 8936843 missense probably benign 0.35
R7081:Abcb4 UTSW 5 8934263 missense probably benign
R7326:Abcb4 UTSW 5 8934226 missense probably benign 0.00
R7375:Abcb4 UTSW 5 8918671 missense probably benign
R7787:Abcb4 UTSW 5 8909220 missense probably damaging 1.00
RF015:Abcb4 UTSW 5 8896594 frame shift probably null
RF047:Abcb4 UTSW 5 8896595 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACACACCAGAGAGTTGACAGCAATG -3'
(R):5'- TAGCTGATGCCCACTTAGCTCACC -3'

Sequencing Primer
(F):5'- GCAATGTCTATGACAATGGTCCTG -3'
(R):5'- AGCTCACCTTTCCAGCAG -3'
Posted On2014-03-28