Mutagenetix > Incidental Mutation

Incidental Mutation 'R1470:Prx'

165811

Institutional Source

Beutler Lab

Gene Symbol

Prx

Ensembl Gene

ENSMUSG00000053198

Gene Name

periaxin

Synonyms

L-Periaxin

MMRRC Submission

039523-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1470 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27499324-27520214 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 27517601 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 648 (M648K)

Ref Sequence

ENSEMBL: ENSMUSP00000096241 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065487] [ENSMUST00000098644] [ENSMUST00000108355] [ENSMUST00000125990]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000065487
AA Change: M648K

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000066110
Gene: ENSMUSG00000053198
AA Change: M648K

Domain	Start	End	E-Value	Type
PDZ	28	100	6.83e-8	SMART
low complexity region	179	232	N/A	INTRINSIC
low complexity region	267	289	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
internal_repeat_3	316	419	9.05e-5	PROSPERO
internal_repeat_2	317	428	7.28e-6	PROSPERO
internal_repeat_1	321	508	8.09e-9	PROSPERO
internal_repeat_1	503	779	8.09e-9	PROSPERO
internal_repeat_2	840	974	7.28e-6	PROSPERO
internal_repeat_3	1176	1268	9.05e-5	PROSPERO
low complexity region	1275	1314	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098644
AA Change: M648K

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000096241
Gene: ENSMUSG00000053198
AA Change: M648K

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
PDZ	28	100	6.83e-8	SMART
low complexity region	179	232	N/A	INTRINSIC
low complexity region	267	289	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
internal_repeat_3	316	419	5.13e-5	PROSPERO
internal_repeat_2	317	428	3.79e-6	PROSPERO
internal_repeat_1	321	508	3.34e-9	PROSPERO
internal_repeat_1	503	779	3.34e-9	PROSPERO
internal_repeat_2	840	974	3.79e-6	PROSPERO
internal_repeat_3	1176	1268	5.13e-5	PROSPERO
low complexity region	1275	1314	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108355

SMART Domains

Protein: ENSMUSP00000103992
Gene: ENSMUSG00000053198

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
PDZ	28	100	6.83e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125990
AA Change: M509K

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.7%
3x: 98.4%
10x: 90.6%
20x: 68.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display locomotor problems as well as difficulty eating and breathing. Demyelination of peripheral nerves develops with age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 123 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,998,331	M3060T	probably benign	Het
Aak1	T	A	6: 86,967,355	S749T	unknown	Het
Abcb4	A	T	5: 8,940,968	I843F	probably damaging	Het
Actr8	T	A	14: 29,986,969	H244Q	possibly damaging	Het
Adgrv1	A	G	13: 81,382,298	Y5886H	probably benign	Het
Agk	T	A	6: 40,386,817	W244R	probably damaging	Het
Ankrd11	C	A	8: 122,899,724	V161L	probably damaging	Het
Arap3	T	C	18: 37,989,196		probably null	Het
Armc3	A	G	2: 19,238,736	M88V	probably benign	Het
Atp13a5	G	T	16: 29,349,015	P109T	probably benign	Het
Avpr1b	T	A	1: 131,600,585	V282D	probably damaging	Het
Baz2b	T	C	2: 59,978,546	K120E	possibly damaging	Het
Cacng6	G	A	7: 3,424,888	C76Y	probably damaging	Het
Cactin	G	T	10: 81,323,151	E279*	probably null	Het
Car9	A	G	4: 43,510,222	Y268C	probably damaging	Het
Ccdc146	T	A	5: 21,319,566	I263F	probably damaging	Het
Cdh16	T	G	8: 104,618,371	S429R	probably benign	Het
Cep250	A	G	2: 155,991,075	E1639G	probably damaging	Het
Ces1d	A	T	8: 93,195,021	V38D	possibly damaging	Het
Chd1	A	T	17: 15,726,283	Q97L	possibly damaging	Het
Ciita	G	A	16: 10,514,468	D898N	possibly damaging	Het
Clstn1	A	G	4: 149,634,722	N336S	possibly damaging	Het
Cntnap5a	A	G	1: 116,259,519	D607G	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Col20a1	C	T	2: 180,994,960	H245Y	probably benign	Het
Coq8b	A	T	7: 27,252,309	T399S	probably benign	Het
Cpn2	A	G	16: 30,260,185	S233P	probably benign	Het
Cryz	G	A	3: 154,606,476	G70D	probably damaging	Het
Def6	T	A	17: 28,225,982	D451E	possibly damaging	Het
Dnah8	T	A	17: 30,747,277	C2480*	probably null	Het
Dnah9	T	C	11: 65,927,822	N3230S	probably benign	Het
Dyrk4	G	T	6: 126,916,374	S15*	probably null	Het
Erc1	T	C	6: 119,694,602	R917G	probably damaging	Het
Frem3	G	T	8: 80,611,191	V38L	probably benign	Het
Gas2l3	T	C	10: 89,413,934	I441V	probably benign	Het
Gm14393	T	A	2: 175,063,981	Y6F	probably damaging	Het
Gm1527	A	G	3: 28,915,268	K256E	possibly damaging	Het
Gm21905	G	T	5: 67,946,397		probably benign	Het
Gtf2ird1	T	A	5: 134,395,802		probably null	Het
Hmces	C	A	6: 87,936,139	T292K	probably benign	Het
Hpse2	G	A	19: 43,388,253	S20L	probably benign	Het
Ikbke	A	T	1: 131,276,487	V23E	probably null	Het
Ino80	A	T	2: 119,379,649	V1387E	probably damaging	Het
Islr	G	T	9: 58,157,306	A306D	probably damaging	Het
Jakmip1	G	A	5: 37,100,838	G276D	probably damaging	Het
Jchain	A	G	5: 88,526,120	V55A	probably benign	Het
Kalrn	T	C	16: 34,187,471	K1350E	probably damaging	Het
Kansl1l	T	C	1: 66,801,997	Q48R	possibly damaging	Het
Kmt5a	T	C	5: 124,447,271	L23P	probably damaging	Het
Lrba	C	T	3: 86,737,142	H381Y	probably damaging	Het
Lrrc32	T	C	7: 98,499,357	V448A	probably benign	Het
Mapkbp1	T	C	2: 120,017,820	M617T	probably damaging	Het
Mfap1a	T	C	2: 121,502,801	M50V	probably benign	Het
Mgam	G	T	6: 40,759,128	A854S	probably damaging	Het
Myo18b	C	A	5: 112,693,033	R2298L	probably damaging	Het
Myo1h	T	A	5: 114,319,704	M92K	probably damaging	Het
Nlrp2	T	A	7: 5,300,951	T192S	probably benign	Het
Nr2f1	A	T	13: 78,198,165	Y137N	possibly damaging	Het
Nup98	T	A	7: 102,147,306	D841V	probably damaging	Het
Nvl	A	G	1: 181,139,262	V59A	probably damaging	Het
Ogdhl	C	A	14: 32,346,788	N948K	probably damaging	Het
Olfr530	A	G	7: 140,373,113	S166P	probably benign	Het
Olfr538	A	G	7: 140,574,749	T199A	probably benign	Het
Olfr578	A	C	7: 102,984,323	Y280*	probably null	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
Osgin1	G	A	8: 119,444,965	R166H	probably damaging	Het
Palb2	G	T	7: 122,107,524	Y740*	probably null	Het
Palb2	A	T	7: 122,107,523	F741I	probably benign	Het
Parvb	G	A	15: 84,271,308	D65N	probably benign	Het
Parvb	G	A	15: 84,271,252	G46D	probably damaging	Het
Pcsk2	A	T	2: 143,546,518	K10*	probably null	Het
Pde3a	C	T	6: 141,466,206	A502V	probably benign	Het
Pfas	T	C	11: 68,991,359	I893V	probably benign	Het
Pla2g4a	A	T	1: 149,840,720	D663E	probably damaging	Het
Prickle2	G	A	6: 92,458,602	P6L	probably damaging	Het
Ptpn21	T	C	12: 98,688,476	N744S	probably benign	Het
Ptprq	C	T	10: 107,718,574	V97M	probably damaging	Het
Pvr	T	C	7: 19,918,624	E122G	possibly damaging	Het
Racgap1	T	C	15: 99,639,775	K15E	probably damaging	Het
Rock1	C	T	18: 10,136,091		probably null	Het
Rorc	T	A	3: 94,397,302	Y331*	probably null	Het
Rpl37	T	C	15: 5,118,614	V91A	probably benign	Het
Rrp36	T	A	17: 46,672,380	K103*	probably null	Het
Ryr3	T	A	2: 112,653,007	M4142L	probably benign	Het
Sash1	A	T	10: 8,789,593	L125H	probably damaging	Het
Scn5a	T	C	9: 119,536,475	M369V	possibly damaging	Het
Sfi1	TCGC	TC	11: 3,146,254		probably null	Het
Sfi1	C	CT	11: 3,146,255		probably null	Het
Siglec1	A	T	2: 131,070,387	N1678K	probably benign	Het
Slc15a5	A	T	6: 138,072,994	V141E	probably benign	Het
Slc8a3	A	T	12: 81,199,710	H856Q	probably benign	Het
Sptlc2	T	A	12: 87,355,640	M171L	probably benign	Het
Srcap	T	A	7: 127,559,727		probably benign	Het
St6gal2	A	G	17: 55,490,943	D310G	probably damaging	Het
Susd2	T	A	10: 75,638,054	D689V	probably damaging	Het
Suz12	A	T	11: 80,019,732	E303V	possibly damaging	Het
Taldo1	C	A	7: 141,398,587	T150K	probably damaging	Het
Tg	T	A	15: 66,849,463	F274I	possibly damaging	Het
Tmem151b	T	C	17: 45,545,737	D259G	probably damaging	Het
Tmem179	G	T	12: 112,501,854	H64Q	probably benign	Het
Tmem236	A	G	2: 14,218,921	T174A	probably benign	Het
Tnc	A	T	4: 63,966,574	N1821K	probably damaging	Het
Tnfrsf11a	A	G	1: 105,825,048	N261S	probably damaging	Het
Trank1	C	A	9: 111,343,232	F96L	possibly damaging	Het
Trim56	T	A	5: 137,113,163	I500F	probably damaging	Het
Ttc30b	G	T	2: 75,937,811	S199R	probably benign	Het
Ttll5	A	G	12: 85,879,394	I321V	possibly damaging	Het
Ttn	C	A	2: 76,778,023	W17852L	probably damaging	Het
Twnk	G	A	19: 45,009,381	V450M	probably damaging	Het
Uba52	A	G	8: 70,509,556	I127T	possibly damaging	Het
Ubr4	T	A	4: 139,421,226		probably null	Het
Uggt1	A	T	1: 36,176,796	M130K	probably benign	Het
Ulk4	T	A	9: 121,081,656	T1101S	probably benign	Het
Urb1	A	G	16: 90,752,014	S2269P	probably benign	Het
Ush2a	G	T	1: 188,400,206	R875L	probably benign	Het
Usp9y	T	A	Y: 1,332,471	H1624L	probably benign	Het
Vipr1	T	C	9: 121,665,520	L308S	possibly damaging	Het
Xdh	T	G	17: 73,891,112	K1260T	probably damaging	Het
Yipf4	A	G	17: 74,493,968	I94V	probably benign	Het
Zfhx4	A	G	3: 5,413,146	*3582W	probably null	Het
Zfp58	T	C	13: 67,492,025	N116D	possibly damaging	Het
Zfp750	C	A	11: 121,511,993	R643L	probably benign	Het
Znfx1	A	G	2: 167,042,587	V51A	possibly damaging	Het

Other mutations in Prx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01023:Prx	APN	7	27519419	missense	probably benign	0.12
IGL01702:Prx	APN	7	27519787	missense	probably benign	0.00
IGL02012:Prx	APN	7	27517901	missense	probably damaging	1.00
IGL02214:Prx	APN	7	27518912	missense	probably damaging	1.00
IGL02498:Prx	APN	7	27518072	missense	probably damaging	1.00
IGL03029:Prx	APN	7	27508061	nonsense	probably null
R0522:Prx	UTSW	7	27518195	missense	probably damaging	0.99
R0655:Prx	UTSW	7	27517421	missense	probably damaging	1.00
R0904:Prx	UTSW	7	27518294	missense	probably damaging	1.00
R1161:Prx	UTSW	7	27519677	missense	probably damaging	1.00
R1170:Prx	UTSW	7	27518007	nonsense	probably null
R1270:Prx	UTSW	7	27518930	missense	probably damaging	0.96
R1470:Prx	UTSW	7	27517601	missense	probably benign	0.19
R1536:Prx	UTSW	7	27517258	missense	probably damaging	0.99
R1721:Prx	UTSW	7	27517523	missense	probably benign	0.19
R1815:Prx	UTSW	7	27516665	missense	probably damaging	1.00
R1848:Prx	UTSW	7	27518888	missense	possibly damaging	0.70
R1894:Prx	UTSW	7	27519110	missense	possibly damaging	0.68
R2179:Prx	UTSW	7	27517985	missense	probably benign
R2207:Prx	UTSW	7	27516788	missense	probably damaging	1.00
R2312:Prx	UTSW	7	27516626	missense	possibly damaging	0.87
R2356:Prx	UTSW	7	27507859	start gained	probably benign
R2519:Prx	UTSW	7	27518243	missense	probably benign	0.43
R2912:Prx	UTSW	7	27516229	missense	probably damaging	1.00
R4717:Prx	UTSW	7	27516727	missense	probably benign	0.07
R4868:Prx	UTSW	7	27517579	missense	probably benign	0.01
R5153:Prx	UTSW	7	27518476	missense	probably damaging	1.00
R5418:Prx	UTSW	7	27517274	missense	probably damaging	0.99
R5653:Prx	UTSW	7	27517604	missense	probably damaging	1.00
R5895:Prx	UTSW	7	27515284	missense	probably damaging	1.00
R6022:Prx	UTSW	7	27517573	missense	probably damaging	1.00
R6112:Prx	UTSW	7	27516548	missense	probably damaging	1.00
R6223:Prx	UTSW	7	27516836	missense	probably damaging	1.00
R6560:Prx	UTSW	7	27515321	missense	probably damaging	1.00
R6888:Prx	UTSW	7	27519634	missense	possibly damaging	0.73
R7530:Prx	UTSW	7	27507972	missense	probably damaging	1.00
R7854:Prx	UTSW	7	27516641	missense	probably damaging	1.00
R8258:Prx	UTSW	7	27519383	missense	probably damaging	1.00
R8259:Prx	UTSW	7	27519383	missense	probably damaging	1.00
R8831:Prx	UTSW	7	27518113	missense	probably damaging	0.99
R9335:Prx	UTSW	7	27518071	missense	probably damaging	1.00
R9602:Prx	UTSW	7	27519020	missense	possibly damaging	0.93
R9717:Prx	UTSW	7	27517986	missense	probably benign	0.32
RF009:Prx	UTSW	7	27518960	missense	probably damaging	1.00
X0028:Prx	UTSW	7	27517733	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGAAGCTACCAGAGATGAAGCTCCC -3'
(R):5'- ATTTCAGGCAGCCGAATGTCCG -3'

Sequencing Primer
(F):5'- ATGTACGACTCCCGGAAGTTC -3'
(R):5'- GCCGAATGTCCGACACTTTG -3'

Posted On

2014-03-28