Incidental Mutation 'R1470:Atp13a5'
ID 165862
Institutional Source Beutler Lab
Gene Symbol Atp13a5
Ensembl Gene ENSMUSG00000048939
Gene Name ATPase type 13A5
Synonyms C630015F21Rik
MMRRC Submission 039523-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1470 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 29231851-29378732 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 29349015 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 109 (P109T)
Ref Sequence ENSEMBL: ENSMUSP00000075204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075806] [ENSMUST00000142681] [ENSMUST00000143373] [ENSMUST00000152040]
AlphaFold Q3TYU2
Predicted Effect probably benign
Transcript: ENSMUST00000075806
AA Change: P109T

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075204
Gene: ENSMUSG00000048939
AA Change: P109T

Pfam:P5-ATPase 17 142 4.1e-31 PFAM
Cation_ATPase_N 163 223 8.78e0 SMART
Pfam:E1-E2_ATPase 228 475 1.5e-35 PFAM
Pfam:Hydrolase 480 759 2.7e-11 PFAM
Pfam:HAD 483 857 1.1e-28 PFAM
Pfam:Cation_ATPase 564 638 1.3e-6 PFAM
transmembrane domain 901 923 N/A INTRINSIC
transmembrane domain 933 950 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
transmembrane domain 1042 1061 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142681
AA Change: P109T

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118627
Gene: ENSMUSG00000048939
AA Change: P109T

Pfam:P5-ATPase 17 142 7.5e-25 PFAM
Cation_ATPase_N 163 223 8.78e0 SMART
Pfam:E1-E2_ATPase 229 475 1e-36 PFAM
Pfam:Hydrolase 480 860 5.9e-16 PFAM
Pfam:HAD 483 857 4e-27 PFAM
Pfam:Hydrolase_like2 565 638 3.7e-8 PFAM
transmembrane domain 901 923 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143373
AA Change: P109T

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121208
Gene: ENSMUSG00000048939
AA Change: P109T

Pfam:P5-ATPase 17 142 1e-24 PFAM
Pfam:E1-E2_ATPase 196 430 3.2e-34 PFAM
Pfam:Hydrolase 435 815 9.1e-16 PFAM
Pfam:HAD 438 812 6.2e-27 PFAM
Pfam:Hydrolase_like2 520 593 4.8e-8 PFAM
transmembrane domain 856 878 N/A INTRINSIC
transmembrane domain 888 905 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
transmembrane domain 997 1016 N/A INTRINSIC
transmembrane domain 1025 1047 N/A INTRINSIC
transmembrane domain 1062 1084 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152040
AA Change: P109T

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114703
Gene: ENSMUSG00000048939
AA Change: P109T

Pfam:P5-ATPase 17 143 1.4e-25 PFAM
Cation_ATPase_N 149 209 8.78e0 SMART
low complexity region 213 227 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.4%
  • 10x: 90.6%
  • 20x: 68.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice show a decreased mean percentage of natural killer cells when compared with controls. Male homozygous mutant mice exhibit impaired sensorimotor gating/attention during prepulse inhibition testing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,998,331 M3060T probably benign Het
Aak1 T A 6: 86,967,355 S749T unknown Het
Abcb4 A T 5: 8,940,968 I843F probably damaging Het
Actr8 T A 14: 29,986,969 H244Q possibly damaging Het
Adgrv1 A G 13: 81,382,298 Y5886H probably benign Het
Agk T A 6: 40,386,817 W244R probably damaging Het
Ankrd11 C A 8: 122,899,724 V161L probably damaging Het
Arap3 T C 18: 37,989,196 probably null Het
Armc3 A G 2: 19,238,736 M88V probably benign Het
Avpr1b T A 1: 131,600,585 V282D probably damaging Het
Baz2b T C 2: 59,978,546 K120E possibly damaging Het
Cacng6 G A 7: 3,424,888 C76Y probably damaging Het
Cactin G T 10: 81,323,151 E279* probably null Het
Car9 A G 4: 43,510,222 Y268C probably damaging Het
Ccdc146 T A 5: 21,319,566 I263F probably damaging Het
Cdh16 T G 8: 104,618,371 S429R probably benign Het
Cep250 A G 2: 155,991,075 E1639G probably damaging Het
Ces1d A T 8: 93,195,021 V38D possibly damaging Het
Chd1 A T 17: 15,726,283 Q97L possibly damaging Het
Ciita G A 16: 10,514,468 D898N possibly damaging Het
Clstn1 A G 4: 149,634,722 N336S possibly damaging Het
Cntnap5a A G 1: 116,259,519 D607G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col20a1 C T 2: 180,994,960 H245Y probably benign Het
Coq8b A T 7: 27,252,309 T399S probably benign Het
Cpn2 A G 16: 30,260,185 S233P probably benign Het
Cryz G A 3: 154,606,476 G70D probably damaging Het
Def6 T A 17: 28,225,982 D451E possibly damaging Het
Dnah8 T A 17: 30,747,277 C2480* probably null Het
Dnah9 T C 11: 65,927,822 N3230S probably benign Het
Dyrk4 G T 6: 126,916,374 S15* probably null Het
Erc1 T C 6: 119,694,602 R917G probably damaging Het
Frem3 G T 8: 80,611,191 V38L probably benign Het
Gas2l3 T C 10: 89,413,934 I441V probably benign Het
Gm14393 T A 2: 175,063,981 Y6F probably damaging Het
Gm1527 A G 3: 28,915,268 K256E possibly damaging Het
Gm21905 G T 5: 67,946,397 probably benign Het
Gtf2ird1 T A 5: 134,395,802 probably null Het
Hmces C A 6: 87,936,139 T292K probably benign Het
Hpse2 G A 19: 43,388,253 S20L probably benign Het
Ikbke A T 1: 131,276,487 V23E probably null Het
Ino80 A T 2: 119,379,649 V1387E probably damaging Het
Islr G T 9: 58,157,306 A306D probably damaging Het
Jakmip1 G A 5: 37,100,838 G276D probably damaging Het
Jchain A G 5: 88,526,120 V55A probably benign Het
Kalrn T C 16: 34,187,471 K1350E probably damaging Het
Kansl1l T C 1: 66,801,997 Q48R possibly damaging Het
Kmt5a T C 5: 124,447,271 L23P probably damaging Het
Lrba C T 3: 86,737,142 H381Y probably damaging Het
Lrrc32 T C 7: 98,499,357 V448A probably benign Het
Mapkbp1 T C 2: 120,017,820 M617T probably damaging Het
Mfap1a T C 2: 121,502,801 M50V probably benign Het
Mgam G T 6: 40,759,128 A854S probably damaging Het
Myo18b C A 5: 112,693,033 R2298L probably damaging Het
Myo1h T A 5: 114,319,704 M92K probably damaging Het
Nlrp2 T A 7: 5,300,951 T192S probably benign Het
Nr2f1 A T 13: 78,198,165 Y137N possibly damaging Het
Nup98 T A 7: 102,147,306 D841V probably damaging Het
Nvl A G 1: 181,139,262 V59A probably damaging Het
Ogdhl C A 14: 32,346,788 N948K probably damaging Het
Olfr530 A G 7: 140,373,113 S166P probably benign Het
Olfr538 A G 7: 140,574,749 T199A probably benign Het
Olfr578 A C 7: 102,984,323 Y280* probably null Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Osgin1 G A 8: 119,444,965 R166H probably damaging Het
Palb2 A T 7: 122,107,523 F741I probably benign Het
Palb2 G T 7: 122,107,524 Y740* probably null Het
Parvb G A 15: 84,271,308 D65N probably benign Het
Parvb G A 15: 84,271,252 G46D probably damaging Het
Pcsk2 A T 2: 143,546,518 K10* probably null Het
Pde3a C T 6: 141,466,206 A502V probably benign Het
Pfas T C 11: 68,991,359 I893V probably benign Het
Pla2g4a A T 1: 149,840,720 D663E probably damaging Het
Prickle2 G A 6: 92,458,602 P6L probably damaging Het
Prx T A 7: 27,517,601 M648K probably benign Het
Ptpn21 T C 12: 98,688,476 N744S probably benign Het
Ptprq C T 10: 107,718,574 V97M probably damaging Het
Pvr T C 7: 19,918,624 E122G possibly damaging Het
Racgap1 T C 15: 99,639,775 K15E probably damaging Het
Rock1 C T 18: 10,136,091 probably null Het
Rorc T A 3: 94,397,302 Y331* probably null Het
Rpl37 T C 15: 5,118,614 V91A probably benign Het
Rrp36 T A 17: 46,672,380 K103* probably null Het
Ryr3 T A 2: 112,653,007 M4142L probably benign Het
Sash1 A T 10: 8,789,593 L125H probably damaging Het
Scn5a T C 9: 119,536,475 M369V possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 C CT 11: 3,146,255 probably null Het
Siglec1 A T 2: 131,070,387 N1678K probably benign Het
Slc15a5 A T 6: 138,072,994 V141E probably benign Het
Slc8a3 A T 12: 81,199,710 H856Q probably benign Het
Sptlc2 T A 12: 87,355,640 M171L probably benign Het
Srcap T A 7: 127,559,727 probably benign Het
St6gal2 A G 17: 55,490,943 D310G probably damaging Het
Susd2 T A 10: 75,638,054 D689V probably damaging Het
Suz12 A T 11: 80,019,732 E303V possibly damaging Het
Taldo1 C A 7: 141,398,587 T150K probably damaging Het
Tg T A 15: 66,849,463 F274I possibly damaging Het
Tmem151b T C 17: 45,545,737 D259G probably damaging Het
Tmem179 G T 12: 112,501,854 H64Q probably benign Het
Tmem236 A G 2: 14,218,921 T174A probably benign Het
Tnc A T 4: 63,966,574 N1821K probably damaging Het
Tnfrsf11a A G 1: 105,825,048 N261S probably damaging Het
Trank1 C A 9: 111,343,232 F96L possibly damaging Het
Trim56 T A 5: 137,113,163 I500F probably damaging Het
Ttc30b G T 2: 75,937,811 S199R probably benign Het
Ttll5 A G 12: 85,879,394 I321V possibly damaging Het
Ttn C A 2: 76,778,023 W17852L probably damaging Het
Twnk G A 19: 45,009,381 V450M probably damaging Het
Uba52 A G 8: 70,509,556 I127T possibly damaging Het
Ubr4 T A 4: 139,421,226 probably null Het
Uggt1 A T 1: 36,176,796 M130K probably benign Het
Ulk4 T A 9: 121,081,656 T1101S probably benign Het
Urb1 A G 16: 90,752,014 S2269P probably benign Het
Ush2a G T 1: 188,400,206 R875L probably benign Het
Usp9y T A Y: 1,332,471 H1624L probably benign Het
Vipr1 T C 9: 121,665,520 L308S possibly damaging Het
Xdh T G 17: 73,891,112 K1260T probably damaging Het
Yipf4 A G 17: 74,493,968 I94V probably benign Het
Zfhx4 A G 3: 5,413,146 *3582W probably null Het
Zfp58 T C 13: 67,492,025 N116D possibly damaging Het
Zfp750 C A 11: 121,511,993 R643L probably benign Het
Znfx1 A G 2: 167,042,587 V51A possibly damaging Het
Other mutations in Atp13a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Atp13a5 APN 16 29267014 nonsense probably null
IGL00583:Atp13a5 APN 16 29275453 splice site probably benign
IGL01472:Atp13a5 APN 16 29275423 missense probably damaging 1.00
IGL01473:Atp13a5 APN 16 29316724 missense probably damaging 1.00
IGL02142:Atp13a5 APN 16 29234563 missense probably benign 0.01
IGL02346:Atp13a5 APN 16 29327736 nonsense probably null
IGL02454:Atp13a5 APN 16 29232808 missense probably benign 0.35
IGL02557:Atp13a5 APN 16 29248182 missense probably benign 0.24
IGL02651:Atp13a5 APN 16 29334091 splice site probably benign
IGL02697:Atp13a5 APN 16 29348532 missense probably benign
IGL02704:Atp13a5 APN 16 29251328 nonsense probably null
IGL02993:Atp13a5 APN 16 29293504 nonsense probably null
IGL03329:Atp13a5 APN 16 29334065 nonsense probably null
IGL03346:Atp13a5 APN 16 29314604 missense probably benign 0.15
IGL03493:Atp13a5 APN 16 29297524 missense probably benign
PIT4810001:Atp13a5 UTSW 16 29314564 missense probably damaging 1.00
R0356:Atp13a5 UTSW 16 29348755 splice site probably benign
R0393:Atp13a5 UTSW 16 29266929 splice site probably benign
R0456:Atp13a5 UTSW 16 29232740 missense probably benign 0.03
R0526:Atp13a5 UTSW 16 29348740 missense probably damaging 0.97
R0632:Atp13a5 UTSW 16 29298208 missense probably benign 0.00
R0674:Atp13a5 UTSW 16 29248350 splice site probably benign
R1417:Atp13a5 UTSW 16 29298235 missense probably benign 0.00
R1470:Atp13a5 UTSW 16 29349015 missense probably benign 0.19
R1515:Atp13a5 UTSW 16 29333974 missense probably benign 0.23
R1659:Atp13a5 UTSW 16 29293433 missense probably benign
R1723:Atp13a5 UTSW 16 29232799 missense possibly damaging 0.88
R1779:Atp13a5 UTSW 16 29314660 missense possibly damaging 0.67
R1794:Atp13a5 UTSW 16 29321709 missense probably damaging 1.00
R1958:Atp13a5 UTSW 16 29314601 missense probably damaging 1.00
R2218:Atp13a5 UTSW 16 29321646 missense probably damaging 0.99
R2282:Atp13a5 UTSW 16 29237321 missense probably damaging 1.00
R2356:Atp13a5 UTSW 16 29281069 missense probably damaging 1.00
R2365:Atp13a5 UTSW 16 29251256 missense probably benign 0.00
R2497:Atp13a5 UTSW 16 29339071 nonsense probably null
R2517:Atp13a5 UTSW 16 29297397 missense possibly damaging 0.79
R3552:Atp13a5 UTSW 16 29310766 missense probably damaging 1.00
R3685:Atp13a5 UTSW 16 29316755 missense probably damaging 1.00
R3957:Atp13a5 UTSW 16 29298194 missense probably benign 0.01
R4433:Atp13a5 UTSW 16 29282024 missense probably damaging 0.99
R4503:Atp13a5 UTSW 16 29293528 missense probably benign 0.37
R4579:Atp13a5 UTSW 16 29248338 critical splice acceptor site probably null
R4632:Atp13a5 UTSW 16 29348719 missense probably damaging 1.00
R4718:Atp13a5 UTSW 16 29248170 missense probably damaging 1.00
R4865:Atp13a5 UTSW 16 29248160 missense probably damaging 0.98
R4899:Atp13a5 UTSW 16 29378500 missense probably damaging 1.00
R4909:Atp13a5 UTSW 16 29334028 missense possibly damaging 0.81
R5011:Atp13a5 UTSW 16 29350748 missense probably damaging 1.00
R5013:Atp13a5 UTSW 16 29350748 missense probably damaging 1.00
R5032:Atp13a5 UTSW 16 29263450 missense probably damaging 1.00
R5226:Atp13a5 UTSW 16 29248279 missense probably damaging 1.00
R5485:Atp13a5 UTSW 16 29281942 critical splice donor site probably null
R5598:Atp13a5 UTSW 16 29257077 intron probably benign
R5945:Atp13a5 UTSW 16 29237243 missense probably benign 0.06
R5958:Atp13a5 UTSW 16 29339042 missense probably damaging 1.00
R6194:Atp13a5 UTSW 16 29308239 missense probably damaging 1.00
R6214:Atp13a5 UTSW 16 29251407 missense probably damaging 1.00
R6273:Atp13a5 UTSW 16 29348737 missense probably benign 0.10
R6376:Atp13a5 UTSW 16 29237252 missense probably benign 0.00
R6431:Atp13a5 UTSW 16 29251402 missense possibly damaging 0.93
R6495:Atp13a5 UTSW 16 29321622 critical splice donor site probably null
R6619:Atp13a5 UTSW 16 29349015 missense probably benign 0.05
R6853:Atp13a5 UTSW 16 29321662 missense possibly damaging 0.94
R6932:Atp13a5 UTSW 16 29281951 missense probably damaging 1.00
R7070:Atp13a5 UTSW 16 29334061 missense possibly damaging 0.88
R7343:Atp13a5 UTSW 16 29321749 missense probably benign 0.01
R7425:Atp13a5 UTSW 16 29297460 nonsense probably null
R7570:Atp13a5 UTSW 16 29266963 missense probably damaging 1.00
R7781:Atp13a5 UTSW 16 29297408 missense probably benign 0.00
R7876:Atp13a5 UTSW 16 29321748 missense possibly damaging 0.93
R8358:Atp13a5 UTSW 16 29348987 missense probably damaging 1.00
R8427:Atp13a5 UTSW 16 29349002 missense possibly damaging 0.65
R8435:Atp13a5 UTSW 16 29280929 critical splice donor site probably null
R8830:Atp13a5 UTSW 16 29248176 missense probably damaging 1.00
R8946:Atp13a5 UTSW 16 29327783 missense probably damaging 0.99
R8950:Atp13a5 UTSW 16 29378496 missense probably damaging 1.00
R9222:Atp13a5 UTSW 16 29314654 missense probably damaging 1.00
R9454:Atp13a5 UTSW 16 29314520 missense possibly damaging 0.55
X0023:Atp13a5 UTSW 16 29310782 missense probably damaging 1.00
Z1088:Atp13a5 UTSW 16 29282062 missense probably benign 0.06
Z1177:Atp13a5 UTSW 16 29280969 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gggaagaaaaggcaggctaac -3'
Posted On 2014-03-28