Incidental Mutation 'R1470:Kalrn'
ID165864
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Namekalirin, RhoGEF kinase
Synonyms2210407G14Rik, Hapip, E530005C20Rik, LOC224126
MMRRC Submission 039523-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R1470 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location33969073-34573532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34187471 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1350 (K1350E)
Ref Sequence ENSEMBL: ENSMUSP00000076088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114947] [ENSMUST00000114949] [ENSMUST00000114953] [ENSMUST00000114954] [ENSMUST00000114960] [ENSMUST00000114961] [ENSMUST00000151491]
PDB Structure
Solution structure of SH3 domain of mouse Kalirin-9a protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000076810
AA Change: K1350E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: K1350E

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000089655
AA Change: K1377E

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: K1377E

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 1003 1.85e-8 SMART
SPEC 1133 1235 4.7e-10 SMART
RhoGEF 1285 1455 3.6e-56 SMART
PH 1469 1582 5.24e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114947
AA Change: K723E

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110597
Gene: ENSMUSG00000061751
AA Change: K723E

DomainStartEndE-ValueType
SPEC 3 112 4.22e-3 SMART
internal_repeat_1 128 187 9.63e-6 PROSPERO
SPEC 239 349 1.85e-8 SMART
SPEC 479 581 4.7e-10 SMART
RhoGEF 631 801 3.6e-56 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114949
AA Change: K727E

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110599
Gene: ENSMUSG00000061751
AA Change: K727E

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 2.9e-5 PROSPERO
SPEC 252 353 8.11e-14 SMART
SPEC 483 585 4.7e-10 SMART
RhoGEF 635 805 3.6e-56 SMART
PH 819 932 5.24e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114953
AA Change: K736E

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110603
Gene: ENSMUSG00000061751
AA Change: K736E

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 4.18e-5 PROSPERO
coiled coil region 217 248 N/A INTRINSIC
SPEC 252 362 1.85e-8 SMART
SPEC 492 594 4.7e-10 SMART
RhoGEF 644 814 3.6e-56 SMART
PH 828 941 5.24e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114954
AA Change: K736E

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110604
Gene: ENSMUSG00000061751
AA Change: K736E

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 4.18e-5 PROSPERO
coiled coil region 217 248 N/A INTRINSIC
SPEC 252 362 1.85e-8 SMART
SPEC 492 594 4.7e-10 SMART
RhoGEF 644 814 3.6e-56 SMART
PH 828 941 5.24e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114960
AA Change: K1368E

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: K1368E

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 994 8.11e-14 SMART
SPEC 1124 1226 4.7e-10 SMART
RhoGEF 1276 1446 3.6e-56 SMART
PH 1460 1573 5.24e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114961
SMART Domains Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SEC14 40 179 2.22e-30 SMART
SPEC 193 309 5.32e-9 SMART
SPEC 315 417 1.19e-11 SMART
SPEC 420 535 1.83e0 SMART
SPEC 541 643 9.84e-13 SMART
SPEC 646 768 2.74e-2 SMART
SPEC 895 996 8.11e-14 SMART
SPEC 1126 1228 4.7e-10 SMART
RhoGEF 1278 1448 3.6e-56 SMART
PH 1462 1575 5.24e-8 SMART
SH3 1642 1703 1.23e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000142817
AA Change: K1345E
SMART Domains Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: K1345E

DomainStartEndE-ValueType
SEC14 16 155 2.22e-30 SMART
SPEC 169 285 5.32e-9 SMART
SPEC 291 393 1.19e-11 SMART
SPEC 396 511 1.83e0 SMART
SPEC 517 619 9.84e-13 SMART
SPEC 622 744 2.74e-2 SMART
SPEC 871 972 8.11e-14 SMART
SPEC 1102 1204 4.7e-10 SMART
RhoGEF 1254 1424 3.6e-56 SMART
PH 1438 1551 5.24e-8 SMART
SH3 1618 1679 1.23e-7 SMART
RhoGEF 1900 2070 1.47e-52 SMART
PH 2090 2195 9.87e-4 SMART
SH3 2291 2352 2.78e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000151491
AA Change: K1124E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: K1124E

DomainStartEndE-ValueType
SEC14 26 165 2.22e-30 SMART
SPEC 179 295 5.32e-9 SMART
SPEC 301 403 1.19e-11 SMART
SPEC 640 750 1.85e-8 SMART
SPEC 880 982 4.7e-10 SMART
RhoGEF 1032 1202 3.6e-56 SMART
PH 1216 1329 5.24e-8 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.4%
  • 10x: 90.6%
  • 20x: 68.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,998,331 M3060T probably benign Het
Aak1 T A 6: 86,967,355 S749T unknown Het
Abcb4 A T 5: 8,940,968 I843F probably damaging Het
Actr8 T A 14: 29,986,969 H244Q possibly damaging Het
Adgrv1 A G 13: 81,382,298 Y5886H probably benign Het
Agk T A 6: 40,386,817 W244R probably damaging Het
Ankrd11 C A 8: 122,899,724 V161L probably damaging Het
Arap3 T C 18: 37,989,196 probably null Het
Armc3 A G 2: 19,238,736 M88V probably benign Het
Atp13a5 G T 16: 29,349,015 P109T probably benign Het
Avpr1b T A 1: 131,600,585 V282D probably damaging Het
Baz2b T C 2: 59,978,546 K120E possibly damaging Het
Cacng6 G A 7: 3,424,888 C76Y probably damaging Het
Cactin G T 10: 81,323,151 E279* probably null Het
Car9 A G 4: 43,510,222 Y268C probably damaging Het
Ccdc146 T A 5: 21,319,566 I263F probably damaging Het
Cdh16 T G 8: 104,618,371 S429R probably benign Het
Cep250 A G 2: 155,991,075 E1639G probably damaging Het
Ces1d A T 8: 93,195,021 V38D possibly damaging Het
Chd1 A T 17: 15,726,283 Q97L possibly damaging Het
Ciita G A 16: 10,514,468 D898N possibly damaging Het
Clstn1 A G 4: 149,634,722 N336S possibly damaging Het
Cntnap5a A G 1: 116,259,519 D607G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col20a1 C T 2: 180,994,960 H245Y probably benign Het
Coq8b A T 7: 27,252,309 T399S probably benign Het
Cpn2 A G 16: 30,260,185 S233P probably benign Het
Cryz G A 3: 154,606,476 G70D probably damaging Het
Def6 T A 17: 28,225,982 D451E possibly damaging Het
Dnah8 T A 17: 30,747,277 C2480* probably null Het
Dnah9 T C 11: 65,927,822 N3230S probably benign Het
Dyrk4 G T 6: 126,916,374 S15* probably null Het
Erc1 T C 6: 119,694,602 R917G probably damaging Het
Frem3 G T 8: 80,611,191 V38L probably benign Het
Gas2l3 T C 10: 89,413,934 I441V probably benign Het
Gm14393 T A 2: 175,063,981 Y6F probably damaging Het
Gm1527 A G 3: 28,915,268 K256E possibly damaging Het
Gm21905 G T 5: 67,946,397 probably benign Het
Gtf2ird1 T A 5: 134,395,802 probably null Het
Hmces C A 6: 87,936,139 T292K probably benign Het
Hpse2 G A 19: 43,388,253 S20L probably benign Het
Ikbke A T 1: 131,276,487 V23E probably null Het
Ino80 A T 2: 119,379,649 V1387E probably damaging Het
Islr G T 9: 58,157,306 A306D probably damaging Het
Jakmip1 G A 5: 37,100,838 G276D probably damaging Het
Jchain A G 5: 88,526,120 V55A probably benign Het
Kansl1l T C 1: 66,801,997 Q48R possibly damaging Het
Kmt5a T C 5: 124,447,271 L23P probably damaging Het
Lrba C T 3: 86,737,142 H381Y probably damaging Het
Lrrc32 T C 7: 98,499,357 V448A probably benign Het
Mapkbp1 T C 2: 120,017,820 M617T probably damaging Het
Mfap1a T C 2: 121,502,801 M50V probably benign Het
Mgam G T 6: 40,759,128 A854S probably damaging Het
Myo18b C A 5: 112,693,033 R2298L probably damaging Het
Myo1h T A 5: 114,319,704 M92K probably damaging Het
Nlrp2 T A 7: 5,300,951 T192S probably benign Het
Nr2f1 A T 13: 78,198,165 Y137N possibly damaging Het
Nup98 T A 7: 102,147,306 D841V probably damaging Het
Nvl A G 1: 181,139,262 V59A probably damaging Het
Ogdhl C A 14: 32,346,788 N948K probably damaging Het
Olfr530 A G 7: 140,373,113 S166P probably benign Het
Olfr538 A G 7: 140,574,749 T199A probably benign Het
Olfr578 A C 7: 102,984,323 Y280* probably null Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Osgin1 G A 8: 119,444,965 R166H probably damaging Het
Palb2 A T 7: 122,107,523 F741I probably benign Het
Palb2 G T 7: 122,107,524 Y740* probably null Het
Parvb G A 15: 84,271,308 D65N probably benign Het
Parvb G A 15: 84,271,252 G46D probably damaging Het
Pcsk2 A T 2: 143,546,518 K10* probably null Het
Pde3a C T 6: 141,466,206 A502V probably benign Het
Pfas T C 11: 68,991,359 I893V probably benign Het
Pla2g4a A T 1: 149,840,720 D663E probably damaging Het
Prickle2 G A 6: 92,458,602 P6L probably damaging Het
Prx T A 7: 27,517,601 M648K probably benign Het
Ptpn21 T C 12: 98,688,476 N744S probably benign Het
Ptprq C T 10: 107,718,574 V97M probably damaging Het
Pvr T C 7: 19,918,624 E122G possibly damaging Het
Racgap1 T C 15: 99,639,775 K15E probably damaging Het
Rock1 C T 18: 10,136,091 probably null Het
Rorc T A 3: 94,397,302 Y331* probably null Het
Rpl37 T C 15: 5,118,614 V91A probably benign Het
Rrp36 T A 17: 46,672,380 K103* probably null Het
Ryr3 T A 2: 112,653,007 M4142L probably benign Het
Sash1 A T 10: 8,789,593 L125H probably damaging Het
Scn5a T C 9: 119,536,475 M369V possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 C CT 11: 3,146,255 probably null Het
Siglec1 A T 2: 131,070,387 N1678K probably benign Het
Slc15a5 A T 6: 138,072,994 V141E probably benign Het
Slc8a3 A T 12: 81,199,710 H856Q probably benign Het
Sptlc2 T A 12: 87,355,640 M171L probably benign Het
Srcap T A 7: 127,559,727 probably benign Het
St6gal2 A G 17: 55,490,943 D310G probably damaging Het
Susd2 T A 10: 75,638,054 D689V probably damaging Het
Suz12 A T 11: 80,019,732 E303V possibly damaging Het
Taldo1 C A 7: 141,398,587 T150K probably damaging Het
Tg T A 15: 66,849,463 F274I possibly damaging Het
Tmem151b T C 17: 45,545,737 D259G probably damaging Het
Tmem179 G T 12: 112,501,854 H64Q probably benign Het
Tmem236 A G 2: 14,218,921 T174A probably benign Het
Tnc A T 4: 63,966,574 N1821K probably damaging Het
Tnfrsf11a A G 1: 105,825,048 N261S probably damaging Het
Trank1 C A 9: 111,343,232 F96L possibly damaging Het
Trim56 T A 5: 137,113,163 I500F probably damaging Het
Ttc30b G T 2: 75,937,811 S199R probably benign Het
Ttll5 A G 12: 85,879,394 I321V possibly damaging Het
Ttn C A 2: 76,778,023 W17852L probably damaging Het
Twnk G A 19: 45,009,381 V450M probably damaging Het
Uba52 A G 8: 70,509,556 I127T possibly damaging Het
Ubr4 T A 4: 139,421,226 probably null Het
Uggt1 A T 1: 36,176,796 M130K probably benign Het
Ulk4 T A 9: 121,081,656 T1101S probably benign Het
Urb1 A G 16: 90,752,014 S2269P probably benign Het
Ush2a G T 1: 188,400,206 R875L probably benign Het
Usp9y T A Y: 1,332,471 H1624L probably benign Het
Vipr1 T C 9: 121,665,520 L308S possibly damaging Het
Xdh T G 17: 73,891,112 K1260T probably damaging Het
Yipf4 A G 17: 74,493,968 I94V probably benign Het
Zfhx4 A G 3: 5,413,146 *3582W probably null Het
Zfp58 T C 13: 67,492,025 N116D possibly damaging Het
Zfp750 C A 11: 121,511,993 R643L probably benign Het
Znfx1 A G 2: 167,042,587 V51A possibly damaging Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 34175722 splice site probably benign
IGL01364:Kalrn APN 16 34262629 missense probably damaging 1.00
IGL01510:Kalrn APN 16 34235330 missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34294161 missense probably damaging 1.00
IGL01934:Kalrn APN 16 34198512 splice site probably null
IGL02059:Kalrn APN 16 34252341 missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34220222 missense probably damaging 1.00
IGL02306:Kalrn APN 16 34310527 missense probably damaging 0.97
IGL02328:Kalrn APN 16 34332224 missense probably damaging 0.98
IGL02532:Kalrn APN 16 34360846 missense probably damaging 1.00
IGL02685:Kalrn APN 16 34513959 nonsense probably null
IGL02696:Kalrn APN 16 34220114 missense probably damaging 1.00
IGL02708:Kalrn APN 16 34392050 missense probably damaging 1.00
IGL02937:Kalrn APN 16 34220130 nonsense probably null
IGL03188:Kalrn APN 16 34314192 missense probably benign 0.01
IGL03289:Kalrn APN 16 34385297 missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34314176 missense probably damaging 0.99
R6808_Kalrn_672 UTSW 16 34027976 missense probably damaging 1.00
PIT4498001:Kalrn UTSW 16 34031582 missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34198514 splice site probably benign
R0043:Kalrn UTSW 16 34054906 missense probably damaging 1.00
R0052:Kalrn UTSW 16 34357171 missense probably damaging 1.00
R0066:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0111:Kalrn UTSW 16 34031590 missense probably damaging 1.00
R0113:Kalrn UTSW 16 34049936 intron probably benign
R0183:Kalrn UTSW 16 34171379 splice site probably null
R0422:Kalrn UTSW 16 34314273 missense probably damaging 0.99
R0498:Kalrn UTSW 16 34054891 missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33993670 splice site probably benign
R0656:Kalrn UTSW 16 34032467 missense probably damaging 1.00
R0671:Kalrn UTSW 16 34116408 missense probably benign 0.04
R0707:Kalrn UTSW 16 34010581 missense possibly damaging 0.88
R0709:Kalrn UTSW 16 34035554 missense probably damaging 1.00
R0834:Kalrn UTSW 16 34049919 missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34385390 missense probably damaging 1.00
R1297:Kalrn UTSW 16 34016498 missense probably damaging 0.99
R1355:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33988803 missense probably benign 0.01
R1398:Kalrn UTSW 16 34212820 missense probably damaging 1.00
R1427:Kalrn UTSW 16 33975754 missense probably damaging 1.00
R1458:Kalrn UTSW 16 34174487 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1557:Kalrn UTSW 16 34314278 missense possibly damaging 0.92
R1559:Kalrn UTSW 16 34010548 missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1703:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R1759:Kalrn UTSW 16 34360950 missense probably damaging 0.97
R1764:Kalrn UTSW 16 34212873 missense probably damaging 1.00
R1824:Kalrn UTSW 16 34294215 missense probably damaging 1.00
R1845:Kalrn UTSW 16 34356961 missense probably damaging 0.99
R1850:Kalrn UTSW 16 33975923 missense probably damaging 0.98
R1921:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1922:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1970:Kalrn UTSW 16 33977524 critical splice donor site probably null
R1991:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1992:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R2001:Kalrn UTSW 16 34028045 missense probably damaging 1.00
R2025:Kalrn UTSW 16 34189736 missense probably damaging 0.96
R2048:Kalrn UTSW 16 34252310 missense probably benign 0.18
R2076:Kalrn UTSW 16 34332143 missense probably benign 0.15
R2118:Kalrn UTSW 16 34332230 missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34307724 missense possibly damaging 0.82
R2145:Kalrn UTSW 16 34009262 unclassified probably benign
R2193:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2234:Kalrn UTSW 16 34176262 splice site probably null
R2404:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34310495 missense probably damaging 1.00
R2903:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34212272 missense probably benign 0.07
R3693:Kalrn UTSW 16 34357315 missense probably damaging 1.00
R3709:Kalrn UTSW 16 34392030 splice site probably null
R3788:Kalrn UTSW 16 34220240 missense probably damaging 1.00
R3833:Kalrn UTSW 16 34039889 nonsense probably null
R3871:Kalrn UTSW 16 34203856 splice site probably null
R3934:Kalrn UTSW 16 34310531 missense probably benign 0.34
R4033:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4057:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4303:Kalrn UTSW 16 34235391 missense probably damaging 1.00
R4402:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33987208 missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34392042 missense probably damaging 0.98
R4583:Kalrn UTSW 16 34235267 missense probably damaging 1.00
R4604:Kalrn UTSW 16 34513926 missense possibly damaging 0.46
R4620:Kalrn UTSW 16 34028705 missense probably damaging 0.99
R4651:Kalrn UTSW 16 34176391 missense probably damaging 1.00
R4703:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4704:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4705:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4760:Kalrn UTSW 16 34198487 missense probably damaging 1.00
R4793:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34356969 missense probably damaging 1.00
R4816:Kalrn UTSW 16 34514019 unclassified probably benign
R4888:Kalrn UTSW 16 34171330 missense probably damaging 1.00
R4952:Kalrn UTSW 16 34357415 intron probably null
R5030:Kalrn UTSW 16 33975742 missense probably benign 0.00
R5045:Kalrn UTSW 16 34314352 nonsense probably null
R5117:Kalrn UTSW 16 34033601 critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34252341 missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34262653 missense probably damaging 1.00
R5432:Kalrn UTSW 16 34053622 missense probably damaging 1.00
R5611:Kalrn UTSW 16 34175780 missense probably damaging 1.00
R5629:Kalrn UTSW 16 34039934 missense possibly damaging 0.77
R5635:Kalrn UTSW 16 34014084 missense probably damaging 1.00
R5713:Kalrn UTSW 16 34016579 missense probably benign
R5716:Kalrn UTSW 16 33987176 missense probably benign 0.01
R5772:Kalrn UTSW 16 33975820 missense probably damaging 1.00
R5797:Kalrn UTSW 16 34212249 missense probably damaging 0.98
R5835:Kalrn UTSW 16 33987091 missense probably benign 0.28
R5895:Kalrn UTSW 16 33975435 utr 3 prime probably benign
R5924:Kalrn UTSW 16 34243833 missense probably damaging 1.00
R5999:Kalrn UTSW 16 34357343 missense probably damaging 1.00
R6010:Kalrn UTSW 16 34010580 missense probably benign 0.06
R6052:Kalrn UTSW 16 34360885 missense probably damaging 1.00
R6122:Kalrn UTSW 16 33985191 missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34212885 missense probably damaging 0.99
R6136:Kalrn UTSW 16 34357111 missense probably damaging 1.00
R6178:Kalrn UTSW 16 34053639 missense possibly damaging 0.88
R6229:Kalrn UTSW 16 34055071 missense probably damaging 1.00
R6376:Kalrn UTSW 16 33975991 missense probably benign
R6397:Kalrn UTSW 16 33992985 missense probably damaging 1.00
R6429:Kalrn UTSW 16 34332164 missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34205302 missense probably damaging 1.00
R6481:Kalrn UTSW 16 34360984 missense probably damaging 1.00
R6597:Kalrn UTSW 16 34182747 missense probably damaging 1.00
R6736:Kalrn UTSW 16 34217923 missense probably damaging 1.00
R6808:Kalrn UTSW 16 34027976 missense probably damaging 1.00
R6897:Kalrn UTSW 16 33975703 missense probably damaging 0.99
R6955:Kalrn UTSW 16 34220136 missense probably damaging 1.00
R7060:Kalrn UTSW 16 34357048 missense probably damaging 0.99
R7064:Kalrn UTSW 16 34217891 missense probably damaging 1.00
R7132:Kalrn UTSW 16 34256227 missense unknown
R7154:Kalrn UTSW 16 34212157 critical splice donor site probably null
R7181:Kalrn UTSW 16 34163077 missense probably benign 0.00
R7234:Kalrn UTSW 16 34176422 missense possibly damaging 0.63
R7235:Kalrn UTSW 16 34175761 missense probably benign 0.18
R7504:Kalrn UTSW 16 34256233 missense unknown
R7563:Kalrn UTSW 16 34392094 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCATCGTAAAGAAGAGGAGCGTCCC -3'
(R):5'- AGTTGCTGTACAACCCATGCTGG -3'

Sequencing Primer
(F):5'- ctcccctccctcccctc -3'
(R):5'- gttcctgccctgacttcc -3'
Posted On2014-03-28