Incidental Mutation 'R1473:Olfr414'
ID165888
Institutional Source Beutler Lab
Gene Symbol Olfr414
Ensembl Gene ENSMUSG00000051509
Gene Nameolfactory receptor 414
SynonymsGA_x6K02T2P20D-20749615-20748662, MOR103-10
MMRRC Submission 039526-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1473 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location174424064-174434747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 174430643 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 72 (W72R)
Ref Sequence ENSEMBL: ENSMUSP00000142051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053178] [ENSMUST00000192358]
Predicted Effect probably damaging
Transcript: ENSMUST00000053178
AA Change: W72R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052426
Gene: ENSMUSG00000051509
AA Change: W72R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.8e-53 PFAM
Pfam:7tm_1 41 290 8.3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192358
AA Change: W72R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142051
Gene: ENSMUSG00000051509
AA Change: W72R

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.9e-29 PFAM
Pfam:7tm_4 139 283 1.1e-45 PFAM
Meta Mutation Damage Score 0.3906 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,068,236 D342G probably damaging Het
Acad8 T C 9: 26,979,041 T293A probably benign Het
Adamts13 C A 2: 26,981,753 Y310* probably null Het
Adcy6 T A 15: 98,592,743 Y1102F probably damaging Het
Ahctf1 G A 1: 179,776,108 T791M probably benign Het
Ahctf1 A G 1: 179,799,279 V18A probably damaging Het
Ampd3 T G 7: 110,804,935 S564R probably damaging Het
Anapc1 A T 2: 128,617,697 I1814K possibly damaging Het
Arl4c A T 1: 88,701,609 L19Q probably damaging Het
Atp6v0e2 T C 6: 48,539,264 Y49H probably damaging Het
Ccdc24 G T 4: 117,869,904 probably benign Het
Clcn6 A C 4: 148,024,156 F139V possibly damaging Het
Col2a1 A G 15: 97,982,908 probably benign Het
Crip2 T A 12: 113,143,500 C29S probably damaging Het
Cyp2a4 A C 7: 26,314,763 N455T probably benign Het
Dhcr7 A G 7: 143,841,368 D113G probably damaging Het
Dhcr7 T C 7: 143,847,068 Y323H probably damaging Het
Dnah7a A C 1: 53,496,014 S2696A probably benign Het
Dnajc12 A G 10: 63,397,244 T55A probably benign Het
Drosha G A 15: 12,912,520 E1075K probably benign Het
Duox2 A G 2: 122,287,121 S911P possibly damaging Het
Ephb2 G A 4: 136,694,058 A327V possibly damaging Het
Espl1 C T 15: 102,320,443 T1711I possibly damaging Het
Fmnl2 A G 2: 52,858,207 K22R possibly damaging Het
Fzd6 T C 15: 39,030,963 F175L probably damaging Het
Gm4737 T A 16: 46,154,819 E65V probably damaging Het
Gm5155 A G 7: 17,905,091 noncoding transcript Het
Gm6526 A G 14: 43,748,846 I76M probably damaging Het
Gm6583 T C 5: 112,354,549 T430A probably benign Het
Gm9881 A T 16: 91,170,735 F34I unknown Het
Gm9892 T C 8: 52,196,614 D148G possibly damaging Het
Grb10 C T 11: 11,934,249 V486I probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hdac4 T C 1: 92,029,968 H108R possibly damaging Het
Hist2h2bb G T 3: 96,270,072 L107F probably damaging Het
Hmcn1 G A 1: 150,772,552 T661I probably benign Het
Icam1 T A 9: 21,027,876 I515N probably damaging Het
Ifi208 A G 1: 173,695,654 R497G possibly damaging Het
Igsf10 A T 3: 59,318,767 V2495E probably damaging Het
Iqgap1 T C 7: 80,734,011 M1102V probably benign Het
Itgb4 A T 11: 115,984,047 N410I probably benign Het
Jup T C 11: 100,379,601 H360R possibly damaging Het
Kif20b T A 19: 34,974,496 S1685T possibly damaging Het
Lins1 T C 7: 66,712,046 probably null Het
Lrig1 T A 6: 94,607,313 T917S probably benign Het
Mast2 A G 4: 116,311,955 S814P probably damaging Het
Mast4 T C 13: 102,772,519 T483A probably damaging Het
Mcpt1 T C 14: 56,019,533 M176T probably benign Het
Mettl22 A G 16: 8,473,961 Q38R probably damaging Het
Mrm2 T C 5: 140,328,688 T131A probably benign Het
Nde1 T G 16: 14,185,864 F71V probably benign Het
Nxn C T 11: 76,263,187 G274D possibly damaging Het
Olfr1230 A T 2: 89,296,906 Y121* probably null Het
Olfr183 A T 16: 58,999,912 T76S probably benign Het
Olfr427 G T 1: 174,099,749 C97F probably damaging Het
Osbp2 T C 11: 3,717,175 probably null Het
Otud7a C A 7: 63,754,629 probably benign Het
Phf3 G A 1: 30,805,940 L1313F probably damaging Het
Pkhd1 A T 1: 20,522,983 D1635E probably benign Het
Plpp1 A G 13: 112,859,664 H171R probably damaging Het
Pofut1 A G 2: 153,261,246 M172V probably damaging Het
Prmt5 A G 14: 54,508,915 F580L probably damaging Het
Rab11fip3 A T 17: 25,991,322 L987Q probably damaging Het
Retnlb T A 16: 48,818,665 C76* probably null Het
Rnf38 T C 4: 44,131,584 N399S probably benign Het
Sbk1 A G 7: 126,292,252 E286G possibly damaging Het
Scin T A 12: 40,077,502 T430S probably benign Het
Sgsm1 T A 5: 113,263,257 T868S probably benign Het
Sipa1l1 G A 12: 82,341,111 R37H probably damaging Het
Smchd1 A T 17: 71,361,837 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Soga1 A T 2: 157,020,448 Y1520* probably null Het
Stk32c C T 7: 139,125,179 R23Q probably damaging Het
Sult1d1 A G 5: 87,564,739 M82T probably benign Het
Tat T C 8: 109,996,918 L346P probably damaging Het
Tenm3 C A 8: 48,310,625 G789V probably damaging Het
Thsd7a C T 6: 12,338,622 S1203N probably benign Het
Tmem191c G A 16: 17,277,962 probably null Het
Tmem268 A G 4: 63,580,338 T239A probably damaging Het
Tmem82 A C 4: 141,616,278 L227R possibly damaging Het
Ttn A T 2: 76,727,032 I29906N probably damaging Het
Txndc15 T C 13: 55,721,574 probably benign Het
Ubqln4 A G 3: 88,565,845 I536V probably benign Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn2r102 A T 17: 19,694,581 I803F probably benign Het
Vmn2r6 G T 3: 64,538,158 Y715* probably null Het
Vmn2r74 A T 7: 85,961,410 C25S probably damaging Het
Wdr38 A G 2: 39,000,979 T261A probably benign Het
Zfp653 T C 9: 22,058,220 E250G possibly damaging Het
Other mutations in Olfr414
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Olfr414 APN 1 174431342 missense probably benign 0.00
IGL01560:Olfr414 APN 1 174430901 missense probably benign 0.17
IGL01795:Olfr414 APN 1 174430649 missense possibly damaging 0.83
IGL03286:Olfr414 APN 1 174431177 missense probably benign 0.01
PIT4131001:Olfr414 UTSW 1 174430824 missense probably damaging 1.00
R0219:Olfr414 UTSW 1 174430466 missense probably benign 0.00
R0492:Olfr414 UTSW 1 174430563 missense possibly damaging 0.95
R1052:Olfr414 UTSW 1 174431135 nonsense probably null
R1054:Olfr414 UTSW 1 174430853 missense probably benign 0.36
R1675:Olfr414 UTSW 1 174431097 missense probably benign
R1774:Olfr414 UTSW 1 174431339 missense probably benign 0.00
R1861:Olfr414 UTSW 1 174431091 missense probably damaging 1.00
R1959:Olfr414 UTSW 1 174430905 missense probably damaging 1.00
R1978:Olfr414 UTSW 1 174431091 missense probably damaging 1.00
R4043:Olfr414 UTSW 1 174431091 missense probably damaging 1.00
R5020:Olfr414 UTSW 1 174430671 missense probably damaging 0.98
R5354:Olfr414 UTSW 1 174430686 missense probably damaging 0.98
R5873:Olfr414 UTSW 1 174430782 missense possibly damaging 0.84
R6053:Olfr414 UTSW 1 174430569 nonsense probably null
Z1176:Olfr414 UTSW 1 174430591 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GCTGTTATTGCTTCGATGCACCTG -3'
(R):5'- TCATGGAACTGAAGAACCCGCTG -3'

Sequencing Primer
(F):5'- ATTCAAGTGGACTGGCACC -3'
(R):5'- CCAGTCTGGGAGGCATGAG -3'
Posted On2014-03-28