Incidental Mutation 'R1473:Hist2h2bb'
ID 165903
Institutional Source Beutler Lab
Gene Symbol Hist2h2bb
Ensembl Gene ENSMUSG00000105827
Gene Name histone cluster 2, H2bb
Synonyms H2b-616
MMRRC Submission 039526-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock # R1473 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 96269752-96270132 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 96270072 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 107 (L107F)
Ref Sequence ENSEMBL: ENSMUSP00000135427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098843] [ENSMUST00000177113]
AlphaFold Q64525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051089
SMART Domains Protein: ENSMUSP00000059105
Gene: ENSMUSG00000050936

DomainStartEndE-ValueType
H2B 28 112 1.48e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098843
SMART Domains Protein: ENSMUSP00000096442
Gene: ENSMUSG00000074403

DomainStartEndE-ValueType
H3 34 136 2.12e-75 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177113
AA Change: L107F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135427
Gene: ENSMUSG00000105827
AA Change: L107F

DomainStartEndE-ValueType
H2B 28 124 1.43e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193036
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-dependent histone that is a member of the histone H2B family. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,068,236 D342G probably damaging Het
Acad8 T C 9: 26,979,041 T293A probably benign Het
Adamts13 C A 2: 26,981,753 Y310* probably null Het
Adcy6 T A 15: 98,592,743 Y1102F probably damaging Het
Ahctf1 G A 1: 179,776,108 T791M probably benign Het
Ahctf1 A G 1: 179,799,279 V18A probably damaging Het
Ampd3 T G 7: 110,804,935 S564R probably damaging Het
Anapc1 A T 2: 128,617,697 I1814K possibly damaging Het
Arl4c A T 1: 88,701,609 L19Q probably damaging Het
Atp6v0e2 T C 6: 48,539,264 Y49H probably damaging Het
Ccdc24 G T 4: 117,869,904 probably benign Het
Clcn6 A C 4: 148,024,156 F139V possibly damaging Het
Col2a1 A G 15: 97,982,908 probably benign Het
Crip2 T A 12: 113,143,500 C29S probably damaging Het
Cyp2a4 A C 7: 26,314,763 N455T probably benign Het
Dhcr7 A G 7: 143,841,368 D113G probably damaging Het
Dhcr7 T C 7: 143,847,068 Y323H probably damaging Het
Dnah7a A C 1: 53,496,014 S2696A probably benign Het
Dnajc12 A G 10: 63,397,244 T55A probably benign Het
Drosha G A 15: 12,912,520 E1075K probably benign Het
Duox2 A G 2: 122,287,121 S911P possibly damaging Het
Ephb2 G A 4: 136,694,058 A327V possibly damaging Het
Espl1 C T 15: 102,320,443 T1711I possibly damaging Het
Fmnl2 A G 2: 52,858,207 K22R possibly damaging Het
Fzd6 T C 15: 39,030,963 F175L probably damaging Het
Gm4737 T A 16: 46,154,819 E65V probably damaging Het
Gm5155 A G 7: 17,905,091 noncoding transcript Het
Gm6526 A G 14: 43,748,846 I76M probably damaging Het
Gm6583 T C 5: 112,354,549 T430A probably benign Het
Gm9881 A T 16: 91,170,735 F34I unknown Het
Gm9892 T C 8: 52,196,614 D148G possibly damaging Het
Grb10 C T 11: 11,934,249 V486I probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hdac4 T C 1: 92,029,968 H108R possibly damaging Het
Hmcn1 G A 1: 150,772,552 T661I probably benign Het
Icam1 T A 9: 21,027,876 I515N probably damaging Het
Ifi208 A G 1: 173,695,654 R497G possibly damaging Het
Igsf10 A T 3: 59,318,767 V2495E probably damaging Het
Iqgap1 T C 7: 80,734,011 M1102V probably benign Het
Itgb4 A T 11: 115,984,047 N410I probably benign Het
Jup T C 11: 100,379,601 H360R possibly damaging Het
Kif20b T A 19: 34,974,496 S1685T possibly damaging Het
Lins1 T C 7: 66,712,046 probably null Het
Lrig1 T A 6: 94,607,313 T917S probably benign Het
Mast2 A G 4: 116,311,955 S814P probably damaging Het
Mast4 T C 13: 102,772,519 T483A probably damaging Het
Mcpt1 T C 14: 56,019,533 M176T probably benign Het
Mettl22 A G 16: 8,473,961 Q38R probably damaging Het
Mrm2 T C 5: 140,328,688 T131A probably benign Het
Nde1 T G 16: 14,185,864 F71V probably benign Het
Nxn C T 11: 76,263,187 G274D possibly damaging Het
Olfr1230 A T 2: 89,296,906 Y121* probably null Het
Olfr183 A T 16: 58,999,912 T76S probably benign Het
Olfr414 T A 1: 174,430,643 W72R probably damaging Het
Olfr427 G T 1: 174,099,749 C97F probably damaging Het
Osbp2 T C 11: 3,717,175 probably null Het
Otud7a C A 7: 63,754,629 probably benign Het
Phf3 G A 1: 30,805,940 L1313F probably damaging Het
Pkhd1 A T 1: 20,522,983 D1635E probably benign Het
Plpp1 A G 13: 112,859,664 H171R probably damaging Het
Pofut1 A G 2: 153,261,246 M172V probably damaging Het
Prmt5 A G 14: 54,508,915 F580L probably damaging Het
Rab11fip3 A T 17: 25,991,322 L987Q probably damaging Het
Retnlb T A 16: 48,818,665 C76* probably null Het
Rnf38 T C 4: 44,131,584 N399S probably benign Het
Sbk1 A G 7: 126,292,252 E286G possibly damaging Het
Scin T A 12: 40,077,502 T430S probably benign Het
Sgsm1 T A 5: 113,263,257 T868S probably benign Het
Sipa1l1 G A 12: 82,341,111 R37H probably damaging Het
Smchd1 A T 17: 71,361,837 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Soga1 A T 2: 157,020,448 Y1520* probably null Het
Stk32c C T 7: 139,125,179 R23Q probably damaging Het
Sult1d1 A G 5: 87,564,739 M82T probably benign Het
Tat T C 8: 109,996,918 L346P probably damaging Het
Tenm3 C A 8: 48,310,625 G789V probably damaging Het
Thsd7a C T 6: 12,338,622 S1203N probably benign Het
Tmem191c G A 16: 17,277,962 probably null Het
Tmem268 A G 4: 63,580,338 T239A probably damaging Het
Tmem82 A C 4: 141,616,278 L227R possibly damaging Het
Ttn A T 2: 76,727,032 I29906N probably damaging Het
Txndc15 T C 13: 55,721,574 probably benign Het
Ubqln4 A G 3: 88,565,845 I536V probably benign Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn2r102 A T 17: 19,694,581 I803F probably benign Het
Vmn2r6 G T 3: 64,538,158 Y715* probably null Het
Vmn2r74 A T 7: 85,961,410 C25S probably damaging Het
Wdr38 A G 2: 39,000,979 T261A probably benign Het
Zfp653 T C 9: 22,058,220 E250G possibly damaging Het
Other mutations in Hist2h2bb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Hist2h2bb APN 3 96269809 unclassified probably benign
R0357:Hist2h2bb UTSW 3 96269788 missense probably null 0.04
R0882:Hist2h2bb UTSW 3 96269744 splice site probably null
R0976:Hist2h2bb UTSW 3 96270086 missense probably benign 0.19
R1507:Hist2h2bb UTSW 3 96269873 missense probably damaging 1.00
R4503:Hist2h2bb UTSW 3 96269924 missense possibly damaging 0.84
R4751:Hist2h2bb UTSW 3 96269151 unclassified probably benign
R4808:Hist2h2bb UTSW 3 96270013 missense probably benign 0.00
R6118:Hist2h2bb UTSW 3 96269951 missense probably damaging 1.00
R6585:Hist2h2bb UTSW 3 96270097 missense probably benign 0.17
R7527:Hist2h2bb UTSW 3 96269870 missense possibly damaging 0.94
R9093:Hist2h2bb UTSW 3 96269974 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AAGTCTGCTCCTGCCCCAAAGAAG -3'
(R):5'- TTTGAAACGCTCGATGTTGCACC -3'

Sequencing Primer
(F):5'- CGCAAGGAGAGCTATTCTGTTTAC -3'
(R):5'- TGCAGGGTAACAGACTCATC -3'
Posted On 2014-03-28