Incidental Mutation 'R1473:Sgsm1'
ID 165913
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, 2410098H20Rik, D5Bwg1524e
MMRRC Submission 039526-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1473 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 113243220-113310786 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 113263257 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 868 (T868S)
Ref Sequence ENSEMBL: ENSMUSP00000046544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000048112
AA Change: T868S

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: T868S

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057209
AA Change: T581S

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216
AA Change: T581S

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
TBC 272 766 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112325
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147856
Predicted Effect probably benign
Transcript: ENSMUST00000154248
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Meta Mutation Damage Score 0.0845 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 98% (88/90)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,068,236 D342G probably damaging Het
Acad8 T C 9: 26,979,041 T293A probably benign Het
Adamts13 C A 2: 26,981,753 Y310* probably null Het
Adcy6 T A 15: 98,592,743 Y1102F probably damaging Het
Ahctf1 G A 1: 179,776,108 T791M probably benign Het
Ahctf1 A G 1: 179,799,279 V18A probably damaging Het
Ampd3 T G 7: 110,804,935 S564R probably damaging Het
Anapc1 A T 2: 128,617,697 I1814K possibly damaging Het
Arl4c A T 1: 88,701,609 L19Q probably damaging Het
Atp6v0e2 T C 6: 48,539,264 Y49H probably damaging Het
Ccdc24 G T 4: 117,869,904 probably benign Het
Clcn6 A C 4: 148,024,156 F139V possibly damaging Het
Col2a1 A G 15: 97,982,908 probably benign Het
Crip2 T A 12: 113,143,500 C29S probably damaging Het
Cyp2a4 A C 7: 26,314,763 N455T probably benign Het
Dhcr7 A G 7: 143,841,368 D113G probably damaging Het
Dhcr7 T C 7: 143,847,068 Y323H probably damaging Het
Dnah7a A C 1: 53,496,014 S2696A probably benign Het
Dnajc12 A G 10: 63,397,244 T55A probably benign Het
Drosha G A 15: 12,912,520 E1075K probably benign Het
Duox2 A G 2: 122,287,121 S911P possibly damaging Het
Ephb2 G A 4: 136,694,058 A327V possibly damaging Het
Espl1 C T 15: 102,320,443 T1711I possibly damaging Het
Fmnl2 A G 2: 52,858,207 K22R possibly damaging Het
Fzd6 T C 15: 39,030,963 F175L probably damaging Het
Gm4737 T A 16: 46,154,819 E65V probably damaging Het
Gm5155 A G 7: 17,905,091 noncoding transcript Het
Gm6526 A G 14: 43,748,846 I76M probably damaging Het
Gm6583 T C 5: 112,354,549 T430A probably benign Het
Gm9881 A T 16: 91,170,735 F34I unknown Het
Gm9892 T C 8: 52,196,614 D148G possibly damaging Het
Grb10 C T 11: 11,934,249 V486I probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hdac4 T C 1: 92,029,968 H108R possibly damaging Het
Hist2h2bb G T 3: 96,270,072 L107F probably damaging Het
Hmcn1 G A 1: 150,772,552 T661I probably benign Het
Icam1 T A 9: 21,027,876 I515N probably damaging Het
Ifi208 A G 1: 173,695,654 R497G possibly damaging Het
Igsf10 A T 3: 59,318,767 V2495E probably damaging Het
Iqgap1 T C 7: 80,734,011 M1102V probably benign Het
Itgb4 A T 11: 115,984,047 N410I probably benign Het
Jup T C 11: 100,379,601 H360R possibly damaging Het
Kif20b T A 19: 34,974,496 S1685T possibly damaging Het
Lins1 T C 7: 66,712,046 probably null Het
Lrig1 T A 6: 94,607,313 T917S probably benign Het
Mast2 A G 4: 116,311,955 S814P probably damaging Het
Mast4 T C 13: 102,772,519 T483A probably damaging Het
Mcpt1 T C 14: 56,019,533 M176T probably benign Het
Mettl22 A G 16: 8,473,961 Q38R probably damaging Het
Mrm2 T C 5: 140,328,688 T131A probably benign Het
Nde1 T G 16: 14,185,864 F71V probably benign Het
Nxn C T 11: 76,263,187 G274D possibly damaging Het
Olfr1230 A T 2: 89,296,906 Y121* probably null Het
Olfr183 A T 16: 58,999,912 T76S probably benign Het
Olfr414 T A 1: 174,430,643 W72R probably damaging Het
Olfr427 G T 1: 174,099,749 C97F probably damaging Het
Osbp2 T C 11: 3,717,175 probably null Het
Otud7a C A 7: 63,754,629 probably benign Het
Phf3 G A 1: 30,805,940 L1313F probably damaging Het
Pkhd1 A T 1: 20,522,983 D1635E probably benign Het
Plpp1 A G 13: 112,859,664 H171R probably damaging Het
Pofut1 A G 2: 153,261,246 M172V probably damaging Het
Prmt5 A G 14: 54,508,915 F580L probably damaging Het
Rab11fip3 A T 17: 25,991,322 L987Q probably damaging Het
Retnlb T A 16: 48,818,665 C76* probably null Het
Rnf38 T C 4: 44,131,584 N399S probably benign Het
Sbk1 A G 7: 126,292,252 E286G possibly damaging Het
Scin T A 12: 40,077,502 T430S probably benign Het
Sipa1l1 G A 12: 82,341,111 R37H probably damaging Het
Smchd1 A T 17: 71,361,837 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Soga1 A T 2: 157,020,448 Y1520* probably null Het
Stk32c C T 7: 139,125,179 R23Q probably damaging Het
Sult1d1 A G 5: 87,564,739 M82T probably benign Het
Tat T C 8: 109,996,918 L346P probably damaging Het
Tenm3 C A 8: 48,310,625 G789V probably damaging Het
Thsd7a C T 6: 12,338,622 S1203N probably benign Het
Tmem191c G A 16: 17,277,962 probably null Het
Tmem268 A G 4: 63,580,338 T239A probably damaging Het
Tmem82 A C 4: 141,616,278 L227R possibly damaging Het
Ttn A T 2: 76,727,032 I29906N probably damaging Het
Txndc15 T C 13: 55,721,574 probably benign Het
Ubqln4 A G 3: 88,565,845 I536V probably benign Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn2r102 A T 17: 19,694,581 I803F probably benign Het
Vmn2r6 G T 3: 64,538,158 Y715* probably null Het
Vmn2r74 A T 7: 85,961,410 C25S probably damaging Het
Wdr38 A G 2: 39,000,979 T261A probably benign Het
Zfp653 T C 9: 22,058,220 E250G possibly damaging Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113245064 missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113276142 missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113276182 splice site probably benign
IGL01602:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113263490 missense probably benign
IGL01920:Sgsm1 APN 5 113273605 missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113286767 splice site probably benign
IGL02387:Sgsm1 APN 5 113253063 missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113286767 splice site probably benign
IGL03177:Sgsm1 APN 5 113250993 missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113285021 missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113255316 missense possibly damaging 0.67
caliente UTSW 5 113280462 intron probably benign
Chili UTSW 5 113258123 intron probably benign
pimiento UTSW 5 113263257 missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113268750 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113288836 missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113279270 splice site probably benign
R0099:Sgsm1 UTSW 5 113274360 splice site probably benign
R0269:Sgsm1 UTSW 5 113286929 critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113263705 missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113288835 missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113263759 missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113310562 missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113245028 missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113285123 splice site probably benign
R0744:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113258842 missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113265874 missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113279485 missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113273711 nonsense probably null
R1535:Sgsm1 UTSW 5 113263269 missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113273617 missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113263515 missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113285400 missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113285404 missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113258123 intron probably benign
R4558:Sgsm1 UTSW 5 113258111 intron probably benign
R4610:Sgsm1 UTSW 5 113255307 missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113260047 critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113282626 missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113280462 intron probably benign
R4992:Sgsm1 UTSW 5 113282620 missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113251039 missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113250957 missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113250956 missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113286838 missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113282656 missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113279131 critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113280380 missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113273646 missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113268846 splice site probably null
R7387:Sgsm1 UTSW 5 113263700 missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113274321 missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113279635 splice site probably null
R7624:Sgsm1 UTSW 5 113274335 nonsense probably null
R7632:Sgsm1 UTSW 5 113276082 missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113253024 missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113274327 missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113266330 missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113282644 missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113255268 missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113251011 missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113260092 missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113263418 missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113287231 missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113284995 missense probably damaging 1.00
R9046:Sgsm1 UTSW 5 113288859 missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113282711 missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113280335 missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113274273 missense unknown
R9377:Sgsm1 UTSW 5 113288875 missense probably damaging 1.00
R9461:Sgsm1 UTSW 5 113276032 critical splice donor site probably null
Z1177:Sgsm1 UTSW 5 113282710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTAAAGTCTGTGAAGGCAGAGG -3'
(R):5'- TCTTAGCACTGAAGACAGCGTCTTG -3'

Sequencing Primer
(F):5'- GAGGGCAacatggtggc -3'
(R):5'- AGATAGCCTTGAGAGTGACCTCC -3'
Posted On 2014-03-28