Incidental Mutation 'R1473:Lrig1'
ID 165917
Institutional Source Beutler Lab
Gene Symbol Lrig1
Ensembl Gene ENSMUSG00000030029
Gene Name leucine-rich repeats and immunoglobulin-like domains 1
Synonyms LIG-1, Img
MMRRC Submission 039526-MU
Accession Numbers

Genbank: NM_008377; MGI: 107935

Essential gene? Non essential (E-score: 0.000) question?
Stock # R1473 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 94604529-94700158 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 94607313 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 917 (T917S)
Ref Sequence ENSEMBL: ENSMUSP00000144963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032105] [ENSMUST00000061118] [ENSMUST00000101126] [ENSMUST00000204235] [ENSMUST00000204645] [ENSMUST00000204764]
AlphaFold P70193
Predicted Effect probably benign
Transcript: ENSMUST00000032105
AA Change: T917S

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032105
Gene: ENSMUSG00000030029
AA Change: T917S

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061118
SMART Domains Protein: ENSMUSP00000058028
Gene: ENSMUSG00000045100

DomainStartEndE-ValueType
Pfam:Mito_carr 2 82 7e-14 PFAM
Pfam:Mito_carr 84 173 4e-16 PFAM
Pfam:Mito_carr 176 269 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101126
AA Change: T917S

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000098686
Gene: ENSMUSG00000030029
AA Change: T917S

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203876
Predicted Effect probably benign
Transcript: ENSMUST00000204235
SMART Domains Protein: ENSMUSP00000145328
Gene: ENSMUSG00000045100

DomainStartEndE-ValueType
Pfam:Mito_carr 2 43 2.7e-7 PFAM
Pfam:Mito_carr 38 82 8.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204645
AA Change: T917S

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144963
Gene: ENSMUSG00000030029
AA Change: T917S

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204764
SMART Domains Protein: ENSMUSP00000144816
Gene: ENSMUSG00000045100

DomainStartEndE-ValueType
Pfam:Mito_carr 2 44 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205173
Meta Mutation Damage Score 0.0749 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 98% (88/90)
MGI Phenotype Strain: 2675424
PHENOTYPE: Homozygous null mice developed psoriasiform epidermal hyperplasia. Homozygotes exhibit hair follicle, epidermis, vertebral, eye and hearing abnormalities, decreased body size and fat amount, and increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,068,236 (GRCm38) D342G probably damaging Het
Acad8 T C 9: 26,979,041 (GRCm38) T293A probably benign Het
Adamts13 C A 2: 26,981,753 (GRCm38) Y310* probably null Het
Adcy6 T A 15: 98,592,743 (GRCm38) Y1102F probably damaging Het
Ahctf1 G A 1: 179,776,108 (GRCm38) T791M probably benign Het
Ahctf1 A G 1: 179,799,279 (GRCm38) V18A probably damaging Het
Ampd3 T G 7: 110,804,935 (GRCm38) S564R probably damaging Het
Anapc1 A T 2: 128,617,697 (GRCm38) I1814K possibly damaging Het
Arl4c A T 1: 88,701,609 (GRCm38) L19Q probably damaging Het
Atp6v0e2 T C 6: 48,539,264 (GRCm38) Y49H probably damaging Het
Ccdc24 G T 4: 117,869,904 (GRCm38) probably benign Het
Clcn6 A C 4: 148,024,156 (GRCm38) F139V possibly damaging Het
Col2a1 A G 15: 97,982,908 (GRCm38) probably benign Het
Crip2 T A 12: 113,143,500 (GRCm38) C29S probably damaging Het
Cyp2a4 A C 7: 26,314,763 (GRCm38) N455T probably benign Het
Dhcr7 T C 7: 143,847,068 (GRCm38) Y323H probably damaging Het
Dhcr7 A G 7: 143,841,368 (GRCm38) D113G probably damaging Het
Dnah7a A C 1: 53,496,014 (GRCm38) S2696A probably benign Het
Dnajc12 A G 10: 63,397,244 (GRCm38) T55A probably benign Het
Drosha G A 15: 12,912,520 (GRCm38) E1075K probably benign Het
Duox2 A G 2: 122,287,121 (GRCm38) S911P possibly damaging Het
Ephb2 G A 4: 136,694,058 (GRCm38) A327V possibly damaging Het
Espl1 C T 15: 102,320,443 (GRCm38) T1711I possibly damaging Het
Fmnl2 A G 2: 52,858,207 (GRCm38) K22R possibly damaging Het
Fzd6 T C 15: 39,030,963 (GRCm38) F175L probably damaging Het
Gm4737 T A 16: 46,154,819 (GRCm38) E65V probably damaging Het
Gm5155 A G 7: 17,905,091 (GRCm38) noncoding transcript Het
Gm6526 A G 14: 43,748,846 (GRCm38) I76M probably damaging Het
Gm6583 T C 5: 112,354,549 (GRCm38) T430A probably benign Het
Gm9881 A T 16: 91,170,735 (GRCm38) F34I unknown Het
Gm9892 T C 8: 52,196,614 (GRCm38) D148G possibly damaging Het
Grb10 C T 11: 11,934,249 (GRCm38) V486I probably damaging Het
Gtf3c3 C T 1: 54,417,778 (GRCm38) A488T probably damaging Het
Hdac4 T C 1: 92,029,968 (GRCm38) H108R possibly damaging Het
Hist2h2bb G T 3: 96,270,072 (GRCm38) L107F probably damaging Het
Hmcn1 G A 1: 150,772,552 (GRCm38) T661I probably benign Het
Icam1 T A 9: 21,027,876 (GRCm38) I515N probably damaging Het
Ifi208 A G 1: 173,695,654 (GRCm38) R497G possibly damaging Het
Igsf10 A T 3: 59,318,767 (GRCm38) V2495E probably damaging Het
Iqgap1 T C 7: 80,734,011 (GRCm38) M1102V probably benign Het
Itgb4 A T 11: 115,984,047 (GRCm38) N410I probably benign Het
Jup T C 11: 100,379,601 (GRCm38) H360R possibly damaging Het
Kif20b T A 19: 34,974,496 (GRCm38) S1685T possibly damaging Het
Lins1 T C 7: 66,712,046 (GRCm38) probably null Het
Mast2 A G 4: 116,311,955 (GRCm38) S814P probably damaging Het
Mast4 T C 13: 102,772,519 (GRCm38) T483A probably damaging Het
Mcpt1 T C 14: 56,019,533 (GRCm38) M176T probably benign Het
Mettl22 A G 16: 8,473,961 (GRCm38) Q38R probably damaging Het
Mrm2 T C 5: 140,328,688 (GRCm38) T131A probably benign Het
Nde1 T G 16: 14,185,864 (GRCm38) F71V probably benign Het
Nxn C T 11: 76,263,187 (GRCm38) G274D possibly damaging Het
Olfr1230 A T 2: 89,296,906 (GRCm38) Y121* probably null Het
Olfr183 A T 16: 58,999,912 (GRCm38) T76S probably benign Het
Olfr414 T A 1: 174,430,643 (GRCm38) W72R probably damaging Het
Olfr427 G T 1: 174,099,749 (GRCm38) C97F probably damaging Het
Osbp2 T C 11: 3,717,175 (GRCm38) probably null Het
Otud7a C A 7: 63,754,629 (GRCm38) probably benign Het
Phf3 G A 1: 30,805,940 (GRCm38) L1313F probably damaging Het
Pkhd1 A T 1: 20,522,983 (GRCm38) D1635E probably benign Het
Plpp1 A G 13: 112,859,664 (GRCm38) H171R probably damaging Het
Pofut1 A G 2: 153,261,246 (GRCm38) M172V probably damaging Het
Prmt5 A G 14: 54,508,915 (GRCm38) F580L probably damaging Het
Rab11fip3 A T 17: 25,991,322 (GRCm38) L987Q probably damaging Het
Retnlb T A 16: 48,818,665 (GRCm38) C76* probably null Het
Rnf38 T C 4: 44,131,584 (GRCm38) N399S probably benign Het
Sbk1 A G 7: 126,292,252 (GRCm38) E286G possibly damaging Het
Scin T A 12: 40,077,502 (GRCm38) T430S probably benign Het
Sgsm1 T A 5: 113,263,257 (GRCm38) T868S probably benign Het
Sipa1l1 G A 12: 82,341,111 (GRCm38) R37H probably damaging Het
Smchd1 A T 17: 71,361,837 (GRCm38) probably benign Het
Sned1 G A 1: 93,281,654 (GRCm38) V830M possibly damaging Het
Soga1 A T 2: 157,020,448 (GRCm38) Y1520* probably null Het
Stk32c C T 7: 139,125,179 (GRCm38) R23Q probably damaging Het
Sult1d1 A G 5: 87,564,739 (GRCm38) M82T probably benign Het
Tat T C 8: 109,996,918 (GRCm38) L346P probably damaging Het
Tenm3 C A 8: 48,310,625 (GRCm38) G789V probably damaging Het
Thsd7a C T 6: 12,338,622 (GRCm38) S1203N probably benign Het
Tmem191c G A 16: 17,277,962 (GRCm38) probably null Het
Tmem268 A G 4: 63,580,338 (GRCm38) T239A probably damaging Het
Tmem82 A C 4: 141,616,278 (GRCm38) L227R possibly damaging Het
Ttn A T 2: 76,727,032 (GRCm38) I29906N probably damaging Het
Txndc15 T C 13: 55,721,574 (GRCm38) probably benign Het
Ubqln4 A G 3: 88,565,845 (GRCm38) I536V probably benign Het
Unc80 C T 1: 66,521,581 (GRCm38) H823Y possibly damaging Het
Vmn2r102 A T 17: 19,694,581 (GRCm38) I803F probably benign Het
Vmn2r6 G T 3: 64,538,158 (GRCm38) Y715* probably null Het
Vmn2r74 A T 7: 85,961,410 (GRCm38) C25S probably damaging Het
Wdr38 A G 2: 39,000,979 (GRCm38) T261A probably benign Het
Zfp653 T C 9: 22,058,220 (GRCm38) E250G possibly damaging Het
Other mutations in Lrig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Lrig1 APN 6 94,611,404 (GRCm38) missense probably damaging 0.99
IGL01356:Lrig1 APN 6 94,609,893 (GRCm38) missense probably damaging 1.00
IGL01356:Lrig1 APN 6 94,654,920 (GRCm38) missense probably benign 0.00
IGL02001:Lrig1 APN 6 94,607,324 (GRCm38) missense probably benign 0.00
IGL02019:Lrig1 APN 6 94,616,429 (GRCm38) missense probably damaging 0.98
IGL02177:Lrig1 APN 6 94,663,996 (GRCm38) missense possibly damaging 0.76
IGL02274:Lrig1 APN 6 94,663,938 (GRCm38) missense possibly damaging 0.90
IGL03197:Lrig1 APN 6 94,606,118 (GRCm38) missense probably benign
IGL03263:Lrig1 APN 6 94,611,647 (GRCm38) missense probably benign 0.00
IGL03327:Lrig1 APN 6 94,606,123 (GRCm38) missense probably benign 0.10
N/A - 293:Lrig1 UTSW 6 94,609,087 (GRCm38) missense probably benign
R0019:Lrig1 UTSW 6 94,607,349 (GRCm38) nonsense probably null
R0019:Lrig1 UTSW 6 94,607,349 (GRCm38) nonsense probably null
R0961:Lrig1 UTSW 6 94,663,914 (GRCm38) splice site probably benign
R1018:Lrig1 UTSW 6 94,622,602 (GRCm38) splice site probably benign
R1381:Lrig1 UTSW 6 94,606,130 (GRCm38) missense probably benign 0.04
R1498:Lrig1 UTSW 6 94,627,987 (GRCm38) missense possibly damaging 0.89
R1888:Lrig1 UTSW 6 94,654,878 (GRCm38) missense probably benign 0.03
R1888:Lrig1 UTSW 6 94,654,878 (GRCm38) missense probably benign 0.03
R2273:Lrig1 UTSW 6 94,608,143 (GRCm38) missense probably damaging 1.00
R2513:Lrig1 UTSW 6 94,617,366 (GRCm38) splice site probably null
R3001:Lrig1 UTSW 6 94,608,777 (GRCm38) missense probably damaging 1.00
R3002:Lrig1 UTSW 6 94,608,777 (GRCm38) missense probably damaging 1.00
R3732:Lrig1 UTSW 6 94,611,576 (GRCm38) missense possibly damaging 0.86
R3732:Lrig1 UTSW 6 94,611,576 (GRCm38) missense possibly damaging 0.86
R3733:Lrig1 UTSW 6 94,611,576 (GRCm38) missense possibly damaging 0.86
R3772:Lrig1 UTSW 6 94,605,817 (GRCm38) missense probably benign 0.00
R4089:Lrig1 UTSW 6 94,609,859 (GRCm38) missense possibly damaging 0.83
R4093:Lrig1 UTSW 6 94,613,578 (GRCm38) missense probably benign 0.10
R4095:Lrig1 UTSW 6 94,613,578 (GRCm38) missense probably benign 0.10
R4225:Lrig1 UTSW 6 94,622,658 (GRCm38) missense probably damaging 1.00
R4917:Lrig1 UTSW 6 94,609,719 (GRCm38) missense probably damaging 1.00
R4951:Lrig1 UTSW 6 94,663,978 (GRCm38) missense probably damaging 1.00
R4976:Lrig1 UTSW 6 94,625,062 (GRCm38) missense probably damaging 1.00
R5000:Lrig1 UTSW 6 94,611,449 (GRCm38) missense probably damaging 1.00
R5149:Lrig1 UTSW 6 94,628,044 (GRCm38) missense possibly damaging 0.93
R5732:Lrig1 UTSW 6 94,699,539 (GRCm38) nonsense probably null
R5988:Lrig1 UTSW 6 94,628,042 (GRCm38) missense probably damaging 0.99
R6064:Lrig1 UTSW 6 94,626,447 (GRCm38) missense probably damaging 1.00
R6292:Lrig1 UTSW 6 94,616,445 (GRCm38) missense probably damaging 1.00
R6723:Lrig1 UTSW 6 94,626,405 (GRCm38) missense probably damaging 1.00
R6815:Lrig1 UTSW 6 94,625,029 (GRCm38) missense probably damaging 1.00
R6889:Lrig1 UTSW 6 94,625,063 (GRCm38) missense probably benign 0.07
R6995:Lrig1 UTSW 6 94,611,629 (GRCm38) missense possibly damaging 0.95
R7404:Lrig1 UTSW 6 94,626,471 (GRCm38) missense probably damaging 1.00
R7487:Lrig1 UTSW 6 94,606,118 (GRCm38) missense probably benign
R7732:Lrig1 UTSW 6 94,626,377 (GRCm38) missense probably benign 0.05
R7915:Lrig1 UTSW 6 94,630,101 (GRCm38) critical splice donor site probably null
R8133:Lrig1 UTSW 6 94,611,629 (GRCm38) missense possibly damaging 0.95
R8768:Lrig1 UTSW 6 94,654,859 (GRCm38) missense possibly damaging 0.88
R9045:Lrig1 UTSW 6 94,608,707 (GRCm38) critical splice donor site probably null
R9227:Lrig1 UTSW 6 94,630,132 (GRCm38) missense probably damaging 1.00
Z1176:Lrig1 UTSW 6 94,609,026 (GRCm38) missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CGAAGTGAAACCTTGTCGGGACAAC -3'
(R):5'- TGCTGGGAAAAGCAGTGGTCTG -3'

Sequencing Primer
(F):5'- TCATAGACTGACTTACCTAAGCG -3'
(R):5'- AAAGCAGTGGTCTGGTGGC -3'
Posted On 2014-03-28