Incidental Mutation 'R1473:Ceacam23'
ID 165918
Institutional Source Beutler Lab
Gene Symbol Ceacam23
Ensembl Gene ENSMUSG00000078793
Gene Name CEA cell adhesion moleculen23
Synonyms Gm5155
MMRRC Submission 039526-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1473 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 17605692-17652935 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) A to G at 17639016 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold A0A3Q4EGJ1
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072381
SMART Domains Protein: ENSMUSP00000072218
Gene: ENSMUSG00000078793

DomainStartEndE-ValueType
IG 40 141 2.27e-2 SMART
IG_like 160 261 2.73e1 SMART
IG_like 277 378 6.69e0 SMART
IG_like 397 498 4.07e1 SMART
IG_like 514 615 6.52e0 SMART
IG_like 634 735 1.05e1 SMART
IG 753 853 1.28e-1 SMART
IGc2 869 933 3.82e-9 SMART
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 98% (88/90)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,056,668 (GRCm39) D342G probably damaging Het
Acad8 T C 9: 26,890,337 (GRCm39) T293A probably benign Het
Adamts13 C A 2: 26,871,765 (GRCm39) Y310* probably null Het
Adcy6 T A 15: 98,490,624 (GRCm39) Y1102F probably damaging Het
Ahctf1 G A 1: 179,603,673 (GRCm39) T791M probably benign Het
Ahctf1 A G 1: 179,626,844 (GRCm39) V18A probably damaging Het
Ahcyl T A 16: 45,975,182 (GRCm39) E65V probably damaging Het
Ampd3 T G 7: 110,404,142 (GRCm39) S564R probably damaging Het
Anapc1 A T 2: 128,459,617 (GRCm39) I1814K possibly damaging Het
Arl4c A T 1: 88,629,331 (GRCm39) L19Q probably damaging Het
Atp6v0e2 T C 6: 48,516,198 (GRCm39) Y49H probably damaging Het
Ccdc121rt3 T C 5: 112,502,415 (GRCm39) T430A probably benign Het
Ccdc24 G T 4: 117,727,101 (GRCm39) probably benign Het
Clcn6 A C 4: 148,108,613 (GRCm39) F139V possibly damaging Het
Col2a1 A G 15: 97,880,789 (GRCm39) probably benign Het
Crip2 T A 12: 113,107,120 (GRCm39) C29S probably damaging Het
Cyp2a4 A C 7: 26,014,188 (GRCm39) N455T probably benign Het
Dhcr7 T C 7: 143,400,805 (GRCm39) Y323H probably damaging Het
Dhcr7 A G 7: 143,395,105 (GRCm39) D113G probably damaging Het
Dnah7a A C 1: 53,535,173 (GRCm39) S2696A probably benign Het
Dnajc12 A G 10: 63,233,023 (GRCm39) T55A probably benign Het
Drosha G A 15: 12,912,606 (GRCm39) E1075K probably benign Het
Duox2 A G 2: 122,117,602 (GRCm39) S911P possibly damaging Het
Ephb2 G A 4: 136,421,369 (GRCm39) A327V possibly damaging Het
Espl1 C T 15: 102,228,878 (GRCm39) T1711I possibly damaging Het
Fmnl2 A G 2: 52,748,219 (GRCm39) K22R possibly damaging Het
Fzd6 T C 15: 38,894,358 (GRCm39) F175L probably damaging Het
Gm6526 A G 14: 43,986,303 (GRCm39) I76M probably damaging Het
Gm9881 A T 16: 90,967,623 (GRCm39) F34I unknown Het
Gm9892 T C 8: 52,649,649 (GRCm39) D148G possibly damaging Het
Grb10 C T 11: 11,884,249 (GRCm39) V486I probably damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
H2bc18 G T 3: 96,177,388 (GRCm39) L107F probably damaging Het
Hdac4 T C 1: 91,957,690 (GRCm39) H108R possibly damaging Het
Hmcn1 G A 1: 150,648,303 (GRCm39) T661I probably benign Het
Icam1 T A 9: 20,939,172 (GRCm39) I515N probably damaging Het
Ifi208 A G 1: 173,523,220 (GRCm39) R497G possibly damaging Het
Igsf10 A T 3: 59,226,188 (GRCm39) V2495E probably damaging Het
Iqgap1 T C 7: 80,383,759 (GRCm39) M1102V probably benign Het
Itgb4 A T 11: 115,874,873 (GRCm39) N410I probably benign Het
Jup T C 11: 100,270,427 (GRCm39) H360R possibly damaging Het
Kif20b T A 19: 34,951,896 (GRCm39) S1685T possibly damaging Het
Lins1 T C 7: 66,361,794 (GRCm39) probably null Het
Lrig1 T A 6: 94,584,294 (GRCm39) T917S probably benign Het
Mast2 A G 4: 116,169,152 (GRCm39) S814P probably damaging Het
Mast4 T C 13: 102,909,027 (GRCm39) T483A probably damaging Het
Mcpt1 T C 14: 56,256,990 (GRCm39) M176T probably benign Het
Mettl22 A G 16: 8,291,825 (GRCm39) Q38R probably damaging Het
Mrm2 T C 5: 140,314,443 (GRCm39) T131A probably benign Het
Mtcl2 A T 2: 156,862,368 (GRCm39) Y1520* probably null Het
Nde1 T G 16: 14,003,728 (GRCm39) F71V probably benign Het
Nxn C T 11: 76,154,013 (GRCm39) G274D possibly damaging Het
Or4c123 A T 2: 89,127,250 (GRCm39) Y121* probably null Het
Or5h17 A T 16: 58,820,275 (GRCm39) T76S probably benign Het
Or6k14 G T 1: 173,927,315 (GRCm39) C97F probably damaging Het
Or6p1 T A 1: 174,258,209 (GRCm39) W72R probably damaging Het
Osbp2 T C 11: 3,667,175 (GRCm39) probably null Het
Otud7a C A 7: 63,404,377 (GRCm39) probably benign Het
Phf3 G A 1: 30,845,021 (GRCm39) L1313F probably damaging Het
Pkhd1 A T 1: 20,593,207 (GRCm39) D1635E probably benign Het
Plpp1 A G 13: 112,996,198 (GRCm39) H171R probably damaging Het
Pofut1 A G 2: 153,103,166 (GRCm39) M172V probably damaging Het
Prmt5 A G 14: 54,746,372 (GRCm39) F580L probably damaging Het
Rab11fip3 A T 17: 26,210,296 (GRCm39) L987Q probably damaging Het
Retnlb T A 16: 48,639,028 (GRCm39) C76* probably null Het
Rnf38 T C 4: 44,131,584 (GRCm39) N399S probably benign Het
Sbk1 A G 7: 125,891,424 (GRCm39) E286G possibly damaging Het
Scin T A 12: 40,127,501 (GRCm39) T430S probably benign Het
Sgsm1 T A 5: 113,411,123 (GRCm39) T868S probably benign Het
Sipa1l1 G A 12: 82,387,885 (GRCm39) R37H probably damaging Het
Smchd1 A T 17: 71,668,832 (GRCm39) probably benign Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Stk32c C T 7: 138,705,095 (GRCm39) R23Q probably damaging Het
Sult1d1 A G 5: 87,712,598 (GRCm39) M82T probably benign Het
Tat T C 8: 110,723,550 (GRCm39) L346P probably damaging Het
Tenm3 C A 8: 48,763,660 (GRCm39) G789V probably damaging Het
Thsd7a C T 6: 12,338,621 (GRCm39) S1203N probably benign Het
Tmem191 G A 16: 17,095,826 (GRCm39) probably null Het
Tmem268 A G 4: 63,498,575 (GRCm39) T239A probably damaging Het
Tmem82 A C 4: 141,343,589 (GRCm39) L227R possibly damaging Het
Ttn A T 2: 76,557,376 (GRCm39) I29906N probably damaging Het
Txndc15 T C 13: 55,869,387 (GRCm39) probably benign Het
Ubqln4 A G 3: 88,473,152 (GRCm39) I536V probably benign Het
Unc80 C T 1: 66,560,740 (GRCm39) H823Y possibly damaging Het
Vmn2r102 A T 17: 19,914,843 (GRCm39) I803F probably benign Het
Vmn2r6 G T 3: 64,445,579 (GRCm39) Y715* probably null Het
Vmn2r74 A T 7: 85,610,618 (GRCm39) C25S probably damaging Het
Wdr38 A G 2: 38,890,991 (GRCm39) T261A probably benign Het
Zfp653 T C 9: 21,969,516 (GRCm39) E250G possibly damaging Het
Other mutations in Ceacam23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ceacam23 APN 7 17,644,622 (GRCm39) missense probably benign 0.32
IGL01085:Ceacam23 APN 7 17,649,616 (GRCm39) missense possibly damaging 0.71
IGL01135:Ceacam23 APN 7 17,636,396 (GRCm39) exon noncoding transcript
IGL01291:Ceacam23 APN 7 17,639,041 (GRCm39) exon noncoding transcript
IGL02252:Ceacam23 APN 7 17,644,457 (GRCm39) missense possibly damaging 0.93
IGL03243:Ceacam23 APN 7 17,652,574 (GRCm39) exon noncoding transcript
R0113:Ceacam23 UTSW 7 17,642,873 (GRCm39) exon noncoding transcript
R0833:Ceacam23 UTSW 7 17,638,906 (GRCm39) missense possibly damaging 0.95
R0836:Ceacam23 UTSW 7 17,638,906 (GRCm39) missense possibly damaging 0.95
R1462:Ceacam23 UTSW 7 17,649,516 (GRCm39) exon noncoding transcript
R1817:Ceacam23 UTSW 7 17,607,255 (GRCm39) exon noncoding transcript
R1905:Ceacam23 UTSW 7 17,607,477 (GRCm39) exon noncoding transcript
R2362:Ceacam23 UTSW 7 17,636,398 (GRCm39) exon noncoding transcript
R3721:Ceacam23 UTSW 7 17,636,663 (GRCm39) missense probably benign 0.41
R4305:Ceacam23 UTSW 7 17,639,118 (GRCm39) missense probably benign 0.19
R4567:Ceacam23 UTSW 7 17,642,891 (GRCm39) missense probably damaging 0.97
R4587:Ceacam23 UTSW 7 17,620,149 (GRCm39) missense possibly damaging 0.47
R4691:Ceacam23 UTSW 7 17,642,891 (GRCm39) missense possibly damaging 0.93
R4989:Ceacam23 UTSW 7 17,639,143 (GRCm39) splice site probably null
R5023:Ceacam23 UTSW 7 17,636,631 (GRCm39) missense probably damaging 1.00
R5024:Ceacam23 UTSW 7 17,644,607 (GRCm39) missense probably benign 0.06
R5274:Ceacam23 UTSW 7 17,649,642 (GRCm39) splice site probably null
R5279:Ceacam23 UTSW 7 17,607,214 (GRCm39) splice site noncoding transcript
R5304:Ceacam23 UTSW 7 17,636,617 (GRCm39) missense probably benign 0.06
R5312:Ceacam23 UTSW 7 17,643,067 (GRCm39) missense probably damaging 1.00
R5899:Ceacam23 UTSW 7 17,651,369 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGTCAAGTTGCTGGTATTCACCTGC -3'
(R):5'- GCCCCAACATGGAGTTACAACAGAG -3'

Sequencing Primer
(F):5'- CACTTCCTCAAAAAGTTGCTGTAGG -3'
(R):5'- TTACAACAGAGAGGGAGTTTGTCTAC -3'
Posted On 2014-03-28