Incidental Mutation 'R1473:Stk32c'
ID 165926
Institutional Source Beutler Lab
Gene Symbol Stk32c
Ensembl Gene ENSMUSG00000015981
Gene Name serine/threonine kinase 32C
Synonyms Pkek, YANK3
MMRRC Submission 039526-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1473 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 138683554-138793223 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 138705095 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 23 (R23Q)
Ref Sequence ENSEMBL: ENSMUSP00000126638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016125] [ENSMUST00000165870]
AlphaFold Q8QZV4
Predicted Effect possibly damaging
Transcript: ENSMUST00000016125
AA Change: R141Q

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000016125
Gene: ENSMUSG00000015981
AA Change: R141Q

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
low complexity region 62 80 N/A INTRINSIC
S_TKc 94 354 9.16e-82 SMART
low complexity region 398 407 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165870
AA Change: R23Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126638
Gene: ENSMUSG00000015981
AA Change: R23Q

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 232 1.2e-30 PFAM
Pfam:Pkinase 1 235 1.5e-51 PFAM
Pfam:Kinase-like 12 223 6.2e-13 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
Meta Mutation Damage Score 0.1447 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. It is thought that this family member is functional in brain due to its high expression levels there. DNA methylation differences have been found in this gene in monozygotic twins that are discordant for adolescent depression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,056,668 (GRCm39) D342G probably damaging Het
Acad8 T C 9: 26,890,337 (GRCm39) T293A probably benign Het
Adamts13 C A 2: 26,871,765 (GRCm39) Y310* probably null Het
Adcy6 T A 15: 98,490,624 (GRCm39) Y1102F probably damaging Het
Ahctf1 G A 1: 179,603,673 (GRCm39) T791M probably benign Het
Ahctf1 A G 1: 179,626,844 (GRCm39) V18A probably damaging Het
Ahcyl T A 16: 45,975,182 (GRCm39) E65V probably damaging Het
Ampd3 T G 7: 110,404,142 (GRCm39) S564R probably damaging Het
Anapc1 A T 2: 128,459,617 (GRCm39) I1814K possibly damaging Het
Arl4c A T 1: 88,629,331 (GRCm39) L19Q probably damaging Het
Atp6v0e2 T C 6: 48,516,198 (GRCm39) Y49H probably damaging Het
Ccdc121rt3 T C 5: 112,502,415 (GRCm39) T430A probably benign Het
Ccdc24 G T 4: 117,727,101 (GRCm39) probably benign Het
Ceacam23 A G 7: 17,639,016 (GRCm39) noncoding transcript Het
Clcn6 A C 4: 148,108,613 (GRCm39) F139V possibly damaging Het
Col2a1 A G 15: 97,880,789 (GRCm39) probably benign Het
Crip2 T A 12: 113,107,120 (GRCm39) C29S probably damaging Het
Cyp2a4 A C 7: 26,014,188 (GRCm39) N455T probably benign Het
Dhcr7 T C 7: 143,400,805 (GRCm39) Y323H probably damaging Het
Dhcr7 A G 7: 143,395,105 (GRCm39) D113G probably damaging Het
Dnah7a A C 1: 53,535,173 (GRCm39) S2696A probably benign Het
Dnajc12 A G 10: 63,233,023 (GRCm39) T55A probably benign Het
Drosha G A 15: 12,912,606 (GRCm39) E1075K probably benign Het
Duox2 A G 2: 122,117,602 (GRCm39) S911P possibly damaging Het
Ephb2 G A 4: 136,421,369 (GRCm39) A327V possibly damaging Het
Espl1 C T 15: 102,228,878 (GRCm39) T1711I possibly damaging Het
Fmnl2 A G 2: 52,748,219 (GRCm39) K22R possibly damaging Het
Fzd6 T C 15: 38,894,358 (GRCm39) F175L probably damaging Het
Gm6526 A G 14: 43,986,303 (GRCm39) I76M probably damaging Het
Gm9881 A T 16: 90,967,623 (GRCm39) F34I unknown Het
Gm9892 T C 8: 52,649,649 (GRCm39) D148G possibly damaging Het
Grb10 C T 11: 11,884,249 (GRCm39) V486I probably damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
H2bc18 G T 3: 96,177,388 (GRCm39) L107F probably damaging Het
Hdac4 T C 1: 91,957,690 (GRCm39) H108R possibly damaging Het
Hmcn1 G A 1: 150,648,303 (GRCm39) T661I probably benign Het
Icam1 T A 9: 20,939,172 (GRCm39) I515N probably damaging Het
Ifi208 A G 1: 173,523,220 (GRCm39) R497G possibly damaging Het
Igsf10 A T 3: 59,226,188 (GRCm39) V2495E probably damaging Het
Iqgap1 T C 7: 80,383,759 (GRCm39) M1102V probably benign Het
Itgb4 A T 11: 115,874,873 (GRCm39) N410I probably benign Het
Jup T C 11: 100,270,427 (GRCm39) H360R possibly damaging Het
Kif20b T A 19: 34,951,896 (GRCm39) S1685T possibly damaging Het
Lins1 T C 7: 66,361,794 (GRCm39) probably null Het
Lrig1 T A 6: 94,584,294 (GRCm39) T917S probably benign Het
Mast2 A G 4: 116,169,152 (GRCm39) S814P probably damaging Het
Mast4 T C 13: 102,909,027 (GRCm39) T483A probably damaging Het
Mcpt1 T C 14: 56,256,990 (GRCm39) M176T probably benign Het
Mettl22 A G 16: 8,291,825 (GRCm39) Q38R probably damaging Het
Mrm2 T C 5: 140,314,443 (GRCm39) T131A probably benign Het
Mtcl2 A T 2: 156,862,368 (GRCm39) Y1520* probably null Het
Nde1 T G 16: 14,003,728 (GRCm39) F71V probably benign Het
Nxn C T 11: 76,154,013 (GRCm39) G274D possibly damaging Het
Or4c123 A T 2: 89,127,250 (GRCm39) Y121* probably null Het
Or5h17 A T 16: 58,820,275 (GRCm39) T76S probably benign Het
Or6k14 G T 1: 173,927,315 (GRCm39) C97F probably damaging Het
Or6p1 T A 1: 174,258,209 (GRCm39) W72R probably damaging Het
Osbp2 T C 11: 3,667,175 (GRCm39) probably null Het
Otud7a C A 7: 63,404,377 (GRCm39) probably benign Het
Phf3 G A 1: 30,845,021 (GRCm39) L1313F probably damaging Het
Pkhd1 A T 1: 20,593,207 (GRCm39) D1635E probably benign Het
Plpp1 A G 13: 112,996,198 (GRCm39) H171R probably damaging Het
Pofut1 A G 2: 153,103,166 (GRCm39) M172V probably damaging Het
Prmt5 A G 14: 54,746,372 (GRCm39) F580L probably damaging Het
Rab11fip3 A T 17: 26,210,296 (GRCm39) L987Q probably damaging Het
Retnlb T A 16: 48,639,028 (GRCm39) C76* probably null Het
Rnf38 T C 4: 44,131,584 (GRCm39) N399S probably benign Het
Sbk1 A G 7: 125,891,424 (GRCm39) E286G possibly damaging Het
Scin T A 12: 40,127,501 (GRCm39) T430S probably benign Het
Sgsm1 T A 5: 113,411,123 (GRCm39) T868S probably benign Het
Sipa1l1 G A 12: 82,387,885 (GRCm39) R37H probably damaging Het
Smchd1 A T 17: 71,668,832 (GRCm39) probably benign Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Sult1d1 A G 5: 87,712,598 (GRCm39) M82T probably benign Het
Tat T C 8: 110,723,550 (GRCm39) L346P probably damaging Het
Tenm3 C A 8: 48,763,660 (GRCm39) G789V probably damaging Het
Thsd7a C T 6: 12,338,621 (GRCm39) S1203N probably benign Het
Tmem191 G A 16: 17,095,826 (GRCm39) probably null Het
Tmem268 A G 4: 63,498,575 (GRCm39) T239A probably damaging Het
Tmem82 A C 4: 141,343,589 (GRCm39) L227R possibly damaging Het
Ttn A T 2: 76,557,376 (GRCm39) I29906N probably damaging Het
Txndc15 T C 13: 55,869,387 (GRCm39) probably benign Het
Ubqln4 A G 3: 88,473,152 (GRCm39) I536V probably benign Het
Unc80 C T 1: 66,560,740 (GRCm39) H823Y possibly damaging Het
Vmn2r102 A T 17: 19,914,843 (GRCm39) I803F probably benign Het
Vmn2r6 G T 3: 64,445,579 (GRCm39) Y715* probably null Het
Vmn2r74 A T 7: 85,610,618 (GRCm39) C25S probably damaging Het
Wdr38 A G 2: 38,890,991 (GRCm39) T261A probably benign Het
Zfp653 T C 9: 21,969,516 (GRCm39) E250G possibly damaging Het
Other mutations in Stk32c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Stk32c APN 7 138,768,069 (GRCm39) missense possibly damaging 0.47
IGL02559:Stk32c APN 7 138,700,606 (GRCm39) missense probably benign 0.00
IGL02805:Stk32c APN 7 138,701,762 (GRCm39) missense probably damaging 1.00
R0531:Stk32c UTSW 7 138,700,636 (GRCm39) missense probably damaging 0.97
R0622:Stk32c UTSW 7 138,768,026 (GRCm39) missense probably benign 0.00
R1140:Stk32c UTSW 7 138,705,095 (GRCm39) missense probably damaging 0.99
R1589:Stk32c UTSW 7 138,698,931 (GRCm39) critical splice donor site probably null
R1697:Stk32c UTSW 7 138,701,740 (GRCm39) missense probably benign 0.25
R1855:Stk32c UTSW 7 138,701,363 (GRCm39) missense probably damaging 0.97
R4290:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R4293:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R4295:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R5323:Stk32c UTSW 7 138,699,276 (GRCm39) missense probably benign 0.07
R5854:Stk32c UTSW 7 138,768,195 (GRCm39) intron probably benign
R5907:Stk32c UTSW 7 138,700,590 (GRCm39) missense probably benign 0.32
R6115:Stk32c UTSW 7 138,700,628 (GRCm39) nonsense probably null
R6117:Stk32c UTSW 7 138,702,839 (GRCm39) nonsense probably null
R6176:Stk32c UTSW 7 138,700,691 (GRCm39) missense probably benign 0.02
R6460:Stk32c UTSW 7 138,685,190 (GRCm39) missense probably damaging 1.00
R6695:Stk32c UTSW 7 138,702,880 (GRCm39) missense probably damaging 1.00
R6745:Stk32c UTSW 7 138,702,809 (GRCm39) missense probably damaging 0.99
R7177:Stk32c UTSW 7 138,684,218 (GRCm39) missense possibly damaging 0.62
R7676:Stk32c UTSW 7 138,685,220 (GRCm39) missense possibly damaging 0.87
R7721:Stk32c UTSW 7 138,768,069 (GRCm39) missense possibly damaging 0.47
R8977:Stk32c UTSW 7 138,705,161 (GRCm39) missense possibly damaging 0.69
R9004:Stk32c UTSW 7 138,702,859 (GRCm39) missense probably damaging 1.00
R9117:Stk32c UTSW 7 138,768,141 (GRCm39) missense unknown
R9481:Stk32c UTSW 7 138,768,173 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACCAGGTCCTGAACACAGAAGCTG -3'
(R):5'- CGAAGTCATCTCATCCCATTGCCG -3'

Sequencing Primer
(F):5'- TCCTGAACACAGAAGCTGAATAG -3'
(R):5'- GGCAAGGAACCCTGACTCTC -3'
Posted On 2014-03-28