Mutagenetix > Incidental Mutation

Incidental Mutation 'R1473:Tenm3'

165930

Institutional Source

Beutler Lab

Gene Symbol

Tenm3

Ensembl Gene

ENSMUSG00000031561

Gene Name

teneurin transmembrane protein 3

Synonyms

Ten-m3, Odz3, 2610100B16Rik

MMRRC Submission

039526-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.598) question?

Stock #

R1473 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48227682-48843951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 48310625 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Valine at position 789 (G789V)

Ref Sequence

ENSEMBL: ENSMUSP00000140141 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000033965
AA Change: G798V

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: G798V

Domain	Start	End	E-Value	Type
Pfam:Ten_N	11	177	6.9e-91	PFAM
Pfam:Ten_N	171	308	1e-72	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2631	2708	1.5e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000190840
AA Change: G789V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: G789V

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	182	7.6e-77	PFAM
Pfam:Ten_N	168	308	6.6e-50	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2630	2708	3.2e-35	PFAM

Meta Mutation Damage Score

0.4070

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

98% (88/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	T	C	19: 57,068,236	D342G	probably damaging	Het
Acad8	T	C	9: 26,979,041	T293A	probably benign	Het
Adamts13	C	A	2: 26,981,753	Y310*	probably null	Het
Adcy6	T	A	15: 98,592,743	Y1102F	probably damaging	Het
Ahctf1	G	A	1: 179,776,108	T791M	probably benign	Het
Ahctf1	A	G	1: 179,799,279	V18A	probably damaging	Het
Ampd3	T	G	7: 110,804,935	S564R	probably damaging	Het
Anapc1	A	T	2: 128,617,697	I1814K	possibly damaging	Het
Arl4c	A	T	1: 88,701,609	L19Q	probably damaging	Het
Atp6v0e2	T	C	6: 48,539,264	Y49H	probably damaging	Het
Ccdc24	G	T	4: 117,869,904		probably benign	Het
Clcn6	A	C	4: 148,024,156	F139V	possibly damaging	Het
Col2a1	A	G	15: 97,982,908		probably benign	Het
Crip2	T	A	12: 113,143,500	C29S	probably damaging	Het
Cyp2a4	A	C	7: 26,314,763	N455T	probably benign	Het
Dhcr7	A	G	7: 143,841,368	D113G	probably damaging	Het
Dhcr7	T	C	7: 143,847,068	Y323H	probably damaging	Het
Dnah7a	A	C	1: 53,496,014	S2696A	probably benign	Het
Dnajc12	A	G	10: 63,397,244	T55A	probably benign	Het
Drosha	G	A	15: 12,912,520	E1075K	probably benign	Het
Duox2	A	G	2: 122,287,121	S911P	possibly damaging	Het
Ephb2	G	A	4: 136,694,058	A327V	possibly damaging	Het
Espl1	C	T	15: 102,320,443	T1711I	possibly damaging	Het
Fmnl2	A	G	2: 52,858,207	K22R	possibly damaging	Het
Fzd6	T	C	15: 39,030,963	F175L	probably damaging	Het
Gm4737	T	A	16: 46,154,819	E65V	probably damaging	Het
Gm5155	A	G	7: 17,905,091		noncoding transcript	Het
Gm6526	A	G	14: 43,748,846	I76M	probably damaging	Het
Gm6583	T	C	5: 112,354,549	T430A	probably benign	Het
Gm9881	A	T	16: 91,170,735	F34I	unknown	Het
Gm9892	T	C	8: 52,196,614	D148G	possibly damaging	Het
Grb10	C	T	11: 11,934,249	V486I	probably damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Hdac4	T	C	1: 92,029,968	H108R	possibly damaging	Het
Hist2h2bb	G	T	3: 96,270,072	L107F	probably damaging	Het
Hmcn1	G	A	1: 150,772,552	T661I	probably benign	Het
Icam1	T	A	9: 21,027,876	I515N	probably damaging	Het
Ifi208	A	G	1: 173,695,654	R497G	possibly damaging	Het
Igsf10	A	T	3: 59,318,767	V2495E	probably damaging	Het
Iqgap1	T	C	7: 80,734,011	M1102V	probably benign	Het
Itgb4	A	T	11: 115,984,047	N410I	probably benign	Het
Jup	T	C	11: 100,379,601	H360R	possibly damaging	Het
Kif20b	T	A	19: 34,974,496	S1685T	possibly damaging	Het
Lins1	T	C	7: 66,712,046		probably null	Het
Lrig1	T	A	6: 94,607,313	T917S	probably benign	Het
Mast2	A	G	4: 116,311,955	S814P	probably damaging	Het
Mast4	T	C	13: 102,772,519	T483A	probably damaging	Het
Mcpt1	T	C	14: 56,019,533	M176T	probably benign	Het
Mettl22	A	G	16: 8,473,961	Q38R	probably damaging	Het
Mrm2	T	C	5: 140,328,688	T131A	probably benign	Het
Nde1	T	G	16: 14,185,864	F71V	probably benign	Het
Nxn	C	T	11: 76,263,187	G274D	possibly damaging	Het
Olfr1230	A	T	2: 89,296,906	Y121*	probably null	Het
Olfr183	A	T	16: 58,999,912	T76S	probably benign	Het
Olfr414	T	A	1: 174,430,643	W72R	probably damaging	Het
Olfr427	G	T	1: 174,099,749	C97F	probably damaging	Het
Osbp2	T	C	11: 3,717,175		probably null	Het
Otud7a	C	A	7: 63,754,629		probably benign	Het
Phf3	G	A	1: 30,805,940	L1313F	probably damaging	Het
Pkhd1	A	T	1: 20,522,983	D1635E	probably benign	Het
Plpp1	A	G	13: 112,859,664	H171R	probably damaging	Het
Pofut1	A	G	2: 153,261,246	M172V	probably damaging	Het
Prmt5	A	G	14: 54,508,915	F580L	probably damaging	Het
Rab11fip3	A	T	17: 25,991,322	L987Q	probably damaging	Het
Retnlb	T	A	16: 48,818,665	C76*	probably null	Het
Rnf38	T	C	4: 44,131,584	N399S	probably benign	Het
Sbk1	A	G	7: 126,292,252	E286G	possibly damaging	Het
Scin	T	A	12: 40,077,502	T430S	probably benign	Het
Sgsm1	T	A	5: 113,263,257	T868S	probably benign	Het
Sipa1l1	G	A	12: 82,341,111	R37H	probably damaging	Het
Smchd1	A	T	17: 71,361,837		probably benign	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Soga1	A	T	2: 157,020,448	Y1520*	probably null	Het
Stk32c	C	T	7: 139,125,179	R23Q	probably damaging	Het
Sult1d1	A	G	5: 87,564,739	M82T	probably benign	Het
Tat	T	C	8: 109,996,918	L346P	probably damaging	Het
Thsd7a	C	T	6: 12,338,622	S1203N	probably benign	Het
Tmem191c	G	A	16: 17,277,962		probably null	Het
Tmem268	A	G	4: 63,580,338	T239A	probably damaging	Het
Tmem82	A	C	4: 141,616,278	L227R	possibly damaging	Het
Ttn	A	T	2: 76,727,032	I29906N	probably damaging	Het
Txndc15	T	C	13: 55,721,574		probably benign	Het
Ubqln4	A	G	3: 88,565,845	I536V	probably benign	Het
Unc80	C	T	1: 66,521,581	H823Y	possibly damaging	Het
Vmn2r102	A	T	17: 19,694,581	I803F	probably benign	Het
Vmn2r6	G	T	3: 64,538,158	Y715*	probably null	Het
Vmn2r74	A	T	7: 85,961,410	C25S	probably damaging	Het
Wdr38	A	G	2: 39,000,979	T261A	probably benign	Het
Zfp653	T	C	9: 22,058,220	E250G	possibly damaging	Het

Other mutations in Tenm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Tenm3	APN	8	48417060	missense	probably damaging	1.00
IGL00538:Tenm3	APN	8	48236025	missense	probably damaging	1.00
IGL00719:Tenm3	APN	8	48279042	missense	probably benign	0.39
IGL00720:Tenm3	APN	8	48276421	missense	probably damaging	0.98
IGL00870:Tenm3	APN	8	48417132	missense	probably benign	0.00
IGL00976:Tenm3	APN	8	48256841	missense	probably benign	0.14
IGL01469:Tenm3	APN	8	48236423	missense	probably damaging	1.00
IGL01508:Tenm3	APN	8	48276645	missense	probably benign	0.09
IGL01590:Tenm3	APN	8	48228802	missense	probably damaging	1.00
IGL01610:Tenm3	APN	8	48254477	missense	probably damaging	1.00
IGL01874:Tenm3	APN	8	48236758	nonsense	probably null
IGL01892:Tenm3	APN	8	48276396	missense	probably benign	0.09
IGL02098:Tenm3	APN	8	48276576	missense	possibly damaging	0.94
IGL02382:Tenm3	APN	8	48235476	missense	probably damaging	1.00
IGL02397:Tenm3	APN	8	48236694	missense	possibly damaging	0.94
IGL02475:Tenm3	APN	8	48279198	splice site	probably benign
IGL02502:Tenm3	APN	8	48288016	missense	probably damaging	1.00
IGL02508:Tenm3	APN	8	48299639	missense	probably benign	0.30
IGL02543:Tenm3	APN	8	48298956	missense	probably damaging	1.00
IGL02723:Tenm3	APN	8	48276903	missense	probably benign	0.02
IGL03037:Tenm3	APN	8	48298878	missense	possibly damaging	0.90
IGL03160:Tenm3	APN	8	48646418	missense	probably benign	0.05
IGL03268:Tenm3	APN	8	48235523	missense	probably damaging	1.00
IGL02988:Tenm3	UTSW	8	48235346	missense	probably damaging	0.99
PIT4431001:Tenm3	UTSW	8	48235607	missense	probably damaging	1.00
PIT4504001:Tenm3	UTSW	8	48293657	missense	probably damaging	1.00
R0079:Tenm3	UTSW	8	48343345	missense	possibly damaging	0.90
R0121:Tenm3	UTSW	8	48342659	missense	probably damaging	0.99
R0123:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0134:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0147:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0148:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0309:Tenm3	UTSW	8	48341034	missense	probably damaging	1.00
R0322:Tenm3	UTSW	8	48236912	splice site	probably benign
R0335:Tenm3	UTSW	8	48232105	missense	probably damaging	1.00
R0355:Tenm3	UTSW	8	48228975	missense	probably damaging	1.00
R0411:Tenm3	UTSW	8	48287791	missense	possibly damaging	0.61
R0505:Tenm3	UTSW	8	48341160	splice site	probably benign
R0573:Tenm3	UTSW	8	48674399	splice site	probably benign
R0599:Tenm3	UTSW	8	48277710	missense	probably damaging	1.00
R0616:Tenm3	UTSW	8	48276156	missense	possibly damaging	0.76
R0637:Tenm3	UTSW	8	48236525	missense	probably damaging	1.00
R0726:Tenm3	UTSW	8	48236594	missense	probably damaging	1.00
R0840:Tenm3	UTSW	8	48335742	missense	probably damaging	0.99
R0981:Tenm3	UTSW	8	48298965	missense	probably damaging	1.00
R1006:Tenm3	UTSW	8	48228542	missense	probably damaging	1.00
R1199:Tenm3	UTSW	8	48235582	missense	probably damaging	0.99
R1223:Tenm3	UTSW	8	48240396	missense	possibly damaging	0.72
R1240:Tenm3	UTSW	8	48287893	missense	possibly damaging	0.74
R1394:Tenm3	UTSW	8	48276400	missense	probably benign
R1455:Tenm3	UTSW	8	48279048	missense	possibly damaging	0.87
R1459:Tenm3	UTSW	8	48235971	missense	probably damaging	1.00
R1501:Tenm3	UTSW	8	48343316	missense	probably damaging	0.99
R1507:Tenm3	UTSW	8	48287822	missense	probably benign	0.01
R1522:Tenm3	UTSW	8	48395576	missense	probably damaging	1.00
R1524:Tenm3	UTSW	8	48228981	missense	possibly damaging	0.92
R1553:Tenm3	UTSW	8	48236421	missense	probably damaging	1.00
R1572:Tenm3	UTSW	8	48228993	missense	possibly damaging	0.94
R1583:Tenm3	UTSW	8	48279074	missense	probably benign	0.09
R1676:Tenm3	UTSW	8	48417119	missense	possibly damaging	0.83
R1732:Tenm3	UTSW	8	48310634	missense	probably damaging	1.00
R1768:Tenm3	UTSW	8	48232104	missense	probably damaging	1.00
R1777:Tenm3	UTSW	8	48417179	missense	probably benign	0.05
R1793:Tenm3	UTSW	8	48674544	missense	probably damaging	0.98
R1801:Tenm3	UTSW	8	48276256	missense	probably benign	0.39
R1863:Tenm3	UTSW	8	48276346	missense	probably benign	0.20
R1898:Tenm3	UTSW	8	48310761	missense	probably damaging	1.00
R1971:Tenm3	UTSW	8	48236313	missense	probably damaging	1.00
R1972:Tenm3	UTSW	8	48228591	missense	probably damaging	1.00
R1996:Tenm3	UTSW	8	48228668	missense	probably damaging	1.00
R2061:Tenm3	UTSW	8	48342256	critical splice donor site	probably null
R2109:Tenm3	UTSW	8	48343349	missense	possibly damaging	0.94
R2124:Tenm3	UTSW	8	48417006	critical splice donor site	probably null
R2190:Tenm3	UTSW	8	48395544	missense	probably damaging	1.00
R2204:Tenm3	UTSW	8	48674550	missense	probably benign	0.17
R2233:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2234:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2235:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2237:Tenm3	UTSW	8	48342337	missense	probably damaging	1.00
R2418:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2419:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2435:Tenm3	UTSW	8	48287953	missense	probably damaging	1.00
R2483:Tenm3	UTSW	8	48240270	missense	probably damaging	0.99
R3406:Tenm3	UTSW	8	48228555	missense	probably damaging	1.00
R3724:Tenm3	UTSW	8	48277746	missense	probably damaging	0.97
R4009:Tenm3	UTSW	8	48349223	missense	probably damaging	1.00
R4210:Tenm3	UTSW	8	48349404	missense	probably damaging	1.00
R4293:Tenm3	UTSW	8	48395658	missense	probably damaging	1.00
R4656:Tenm3	UTSW	8	48293726	missense	probably damaging	1.00
R4663:Tenm3	UTSW	8	48235970	missense	probably damaging	1.00
R4835:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R4851:Tenm3	UTSW	8	48310621	critical splice donor site	probably null
R4867:Tenm3	UTSW	8	48235821	missense	probably damaging	1.00
R4892:Tenm3	UTSW	8	48276861	missense	probably damaging	0.99
R4895:Tenm3	UTSW	8	48300971	missense	probably damaging	1.00
R4962:Tenm3	UTSW	8	48278961	nonsense	probably null
R4995:Tenm3	UTSW	8	48229137	missense	possibly damaging	0.87
R4996:Tenm3	UTSW	8	48235826	missense	probably damaging	0.97
R5091:Tenm3	UTSW	8	48342308	missense	probably benign	0.14
R5228:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5253:Tenm3	UTSW	8	48229198	missense	possibly damaging	0.92
R5260:Tenm3	UTSW	8	48236855	missense	probably damaging	1.00
R5363:Tenm3	UTSW	8	48287831	missense	possibly damaging	0.55
R5414:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5427:Tenm3	UTSW	8	48236564	missense	probably damaging	1.00
R5431:Tenm3	UTSW	8	48367377	nonsense	probably null
R5566:Tenm3	UTSW	8	48279006	missense	probably damaging	1.00
R5579:Tenm3	UTSW	8	48236764	missense	probably damaging	1.00
R5656:Tenm3	UTSW	8	48228762	missense	probably damaging	1.00
R5931:Tenm3	UTSW	8	48646498	missense	probably benign	0.00
R5959:Tenm3	UTSW	8	48646447	nonsense	probably null
R5965:Tenm3	UTSW	8	48228508	nonsense	probably null
R6062:Tenm3	UTSW	8	48343406	missense	possibly damaging	0.46
R6151:Tenm3	UTSW	8	48395573	missense	probably damaging	1.00
R6157:Tenm3	UTSW	8	48298808	missense	probably damaging	0.96
R6167:Tenm3	UTSW	8	48254622	missense	possibly damaging	0.46
R6217:Tenm3	UTSW	8	48293665	missense	probably damaging	0.99
R6233:Tenm3	UTSW	8	48417059	missense	probably damaging	1.00
R6270:Tenm3	UTSW	8	48367394	missense	probably damaging	0.98
R6329:Tenm3	UTSW	8	48276849	missense	probably damaging	0.99
R6466:Tenm3	UTSW	8	48236063	missense	probably damaging	0.97
R6515:Tenm3	UTSW	8	48417222	missense	probably benign
R6516:Tenm3	UTSW	8	48417222	missense	probably benign
R6747:Tenm3	UTSW	8	48343243	missense	probably damaging	1.00
R6782:Tenm3	UTSW	8	48646256	critical splice donor site	probably null
R6788:Tenm3	UTSW	8	48674493	missense	probably damaging	1.00
R6823:Tenm3	UTSW	8	48256837	missense	probably damaging	0.99
R6846:Tenm3	UTSW	8	48276738	missense	probably benign	0.39
R6913:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R6941:Tenm3	UTSW	8	48674416	missense	probably damaging	0.99
R6950:Tenm3	UTSW	8	48240479	nonsense	probably null
R6968:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6970:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6993:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R7003:Tenm3	UTSW	8	48240444	missense	probably damaging	1.00
R7125:Tenm3	UTSW	8	48674553	missense	probably benign	0.00
R7140:Tenm3	UTSW	8	48292236	missense	probably damaging	1.00
R7222:Tenm3	UTSW	8	48300969	missense	probably damaging	1.00
R7232:Tenm3	UTSW	8	48235935	missense	probably damaging	1.00
R7336:Tenm3	UTSW	8	48236177	missense	possibly damaging	0.93
R7417:Tenm3	UTSW	8	48236183	missense	probably damaging	1.00
R7526:Tenm3	UTSW	8	48287812	missense	probably damaging	0.96
R7527:Tenm3	UTSW	8	48276600	missense	possibly damaging	0.60
R7616:Tenm3	UTSW	8	48341049	missense	possibly damaging	0.56
R7662:Tenm3	UTSW	8	48335727	missense	probably benign	0.27
R7734:Tenm3	UTSW	8	48646333	missense	probably damaging	1.00
R7802:Tenm3	UTSW	8	48236465	missense	probably damaging	1.00
R7812:Tenm3	UTSW	8	48276300	missense	probably benign	0.01
R7843:Tenm3	UTSW	8	48229111	nonsense	probably null
R7951:Tenm3	UTSW	8	48310703	missense	possibly damaging	0.86
R8293:Tenm3	UTSW	8	48367422	missense	possibly damaging	0.91
R8336:Tenm3	UTSW	8	48293773	missense	probably damaging	1.00
R8351:Tenm3	UTSW	8	48287872	missense	probably damaging	0.96
R8387:Tenm3	UTSW	8	48287848	missense	probably damaging	0.98
R8414:Tenm3	UTSW	8	48293509	missense	probably damaging	1.00
R8451:Tenm3	UTSW	8	48287872	missense	probably damaging	0.96
R8465:Tenm3	UTSW	8	48229181	missense	probably damaging	1.00
R8528:Tenm3	UTSW	8	48342633	missense	probably damaging	1.00
R8717:Tenm3	UTSW	8	48299645	missense	possibly damaging	0.77
R8734:Tenm3	UTSW	8	48349356	missense	probably benign	0.16
R8781:Tenm3	UTSW	8	48342449	frame shift	probably null
R8820:Tenm3	UTSW	8	48310724	missense	probably damaging	0.96
R8821:Tenm3	UTSW	8	48276382	missense
R8831:Tenm3	UTSW	8	48276382	missense
R8853:Tenm3	UTSW	8	48342347	missense	probably damaging	1.00
R8900:Tenm3	UTSW	8	48236402	missense	probably damaging	1.00
R8931:Tenm3	UTSW	8	48235602	missense	probably damaging	1.00
R8933:Tenm3	UTSW	8	48279060	missense	possibly damaging	0.53
R8989:Tenm3	UTSW	8	48235348	nonsense	probably null
R8998:Tenm3	UTSW	8	48276687	missense	probably damaging	1.00
R9008:Tenm3	UTSW	8	48342653	missense	probably damaging	0.98
R9017:Tenm3	UTSW	8	48254633	missense	probably damaging	0.99
R9101:Tenm3	UTSW	8	48292151	missense	probably damaging	1.00
R9108:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R9142:Tenm3	UTSW	8	48335513	missense	unknown
R9231:Tenm3	UTSW	8	48236196	missense	probably damaging	1.00
R9309:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R9310:Tenm3	UTSW	8	48555900	unclassified	probably benign
R9336:Tenm3	UTSW	8	48417080	missense	probably damaging	1.00
R9373:Tenm3	UTSW	8	48299655	missense	probably damaging	1.00
R9393:Tenm3	UTSW	8	48674524	missense	probably damaging	0.99
R9509:Tenm3	UTSW	8	48313257	nonsense	probably null
R9575:Tenm3	UTSW	8	48235761	missense	possibly damaging	0.94
R9698:Tenm3	UTSW	8	48236211	missense	probably damaging	1.00
R9722:Tenm3	UTSW	8	48300814	missense	probably benign	0.00
R9788:Tenm3	UTSW	8	48335561	missense	probably benign	0.02
X0010:Tenm3	UTSW	8	48287829	missense	probably damaging	0.98
X0025:Tenm3	UTSW	8	48236477	missense	probably damaging	1.00
Z1177:Tenm3	UTSW	8	48276780	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGTGCAATCAAGCCATCAGCAG -3'
(R):5'- GTCTCAAGGGTCAGGCCAATCAAAG -3'

Sequencing Primer
(F):5'- ATCAGCAGCCACACATTTTC -3'
(R):5'- TTCAATCCTCAAATCAGCGGTG -3'

Posted On

2014-03-28