Incidental Mutation 'R1473:Osbp2'
ID 165937
Institutional Source Beutler Lab
Gene Symbol Osbp2
Ensembl Gene ENSMUSG00000020435
Gene Name oxysterol binding protein 2
Synonyms OSBPL1, 1700095P05Rik, C630001G20Rik, ORP-4
MMRRC Submission 039526-MU
Accession Numbers

Genbank: NM_152818; MGI: 1921559

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R1473 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 3703731-3863903 bp(-) (GRCm38)
Type of Mutation splice site (737 bp from exon)
DNA Base Change (assembly) T to C at 3717175 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070552] [ENSMUST00000101632] [ENSMUST00000102950] [ENSMUST00000127371] [ENSMUST00000155197]
AlphaFold Q5QNQ6
Predicted Effect probably benign
Transcript: ENSMUST00000070552
AA Change: D445G

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068652
Gene: ENSMUSG00000020435
AA Change: D445G

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
PH 180 273 1.12e-16 SMART
low complexity region 281 311 N/A INTRINSIC
Blast:PH 312 394 1e-32 BLAST
low complexity region 424 437 N/A INTRINSIC
Pfam:Oxysterol_BP 519 894 3.5e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101632
AA Change: D34G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099156
Gene: ENSMUSG00000020435
AA Change: D34G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Oxysterol_BP 108 484 2.1e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102950
SMART Domains Protein: ENSMUSP00000100015
Gene: ENSMUSG00000020435

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 66 442 2.8e-132 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127371
SMART Domains Protein: ENSMUSP00000116361
Gene: ENSMUSG00000020435

DomainStartEndE-ValueType
low complexity region 24 39 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
Blast:PH 55 137 8e-37 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000155197
Meta Mutation Damage Score 0.1361 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the oxysterol-binding protein-related family of proteins, which are defined by a C-terminal sterol domain with a highly conserved EQVSHHPP motif. Oxysterols are oxygenated derivatives of cholesterol that are involved in mechanisms that include apoptosis, cholesterol homeostasis, lipid trafficking and cell differentiation. This protein is selectively expressed at high levels in the brain and testis. Within the testis, the mRNA is localized to postmeiotic germ cells, including spermatids and spermatozoa, but is not detectable in somatic cells. Mice homozygous mutant for a targeted deletion in this gene do not exhibit overt developmental phenotypes but are male sterile. Females display normal fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with sperm defects including oligozoospermia, teratozoospermia, asthenozoospermia and abnormal spermiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,068,236 D342G probably damaging Het
Acad8 T C 9: 26,979,041 T293A probably benign Het
Adamts13 C A 2: 26,981,753 Y310* probably null Het
Adcy6 T A 15: 98,592,743 Y1102F probably damaging Het
Ahctf1 G A 1: 179,776,108 T791M probably benign Het
Ahctf1 A G 1: 179,799,279 V18A probably damaging Het
Ampd3 T G 7: 110,804,935 S564R probably damaging Het
Anapc1 A T 2: 128,617,697 I1814K possibly damaging Het
Arl4c A T 1: 88,701,609 L19Q probably damaging Het
Atp6v0e2 T C 6: 48,539,264 Y49H probably damaging Het
Ccdc24 G T 4: 117,869,904 probably benign Het
Clcn6 A C 4: 148,024,156 F139V possibly damaging Het
Col2a1 A G 15: 97,982,908 probably benign Het
Crip2 T A 12: 113,143,500 C29S probably damaging Het
Cyp2a4 A C 7: 26,314,763 N455T probably benign Het
Dhcr7 A G 7: 143,841,368 D113G probably damaging Het
Dhcr7 T C 7: 143,847,068 Y323H probably damaging Het
Dnah7a A C 1: 53,496,014 S2696A probably benign Het
Dnajc12 A G 10: 63,397,244 T55A probably benign Het
Drosha G A 15: 12,912,520 E1075K probably benign Het
Duox2 A G 2: 122,287,121 S911P possibly damaging Het
Ephb2 G A 4: 136,694,058 A327V possibly damaging Het
Espl1 C T 15: 102,320,443 T1711I possibly damaging Het
Fmnl2 A G 2: 52,858,207 K22R possibly damaging Het
Fzd6 T C 15: 39,030,963 F175L probably damaging Het
Gm4737 T A 16: 46,154,819 E65V probably damaging Het
Gm5155 A G 7: 17,905,091 noncoding transcript Het
Gm6526 A G 14: 43,748,846 I76M probably damaging Het
Gm6583 T C 5: 112,354,549 T430A probably benign Het
Gm9881 A T 16: 91,170,735 F34I unknown Het
Gm9892 T C 8: 52,196,614 D148G possibly damaging Het
Grb10 C T 11: 11,934,249 V486I probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hdac4 T C 1: 92,029,968 H108R possibly damaging Het
Hist2h2bb G T 3: 96,270,072 L107F probably damaging Het
Hmcn1 G A 1: 150,772,552 T661I probably benign Het
Icam1 T A 9: 21,027,876 I515N probably damaging Het
Ifi208 A G 1: 173,695,654 R497G possibly damaging Het
Igsf10 A T 3: 59,318,767 V2495E probably damaging Het
Iqgap1 T C 7: 80,734,011 M1102V probably benign Het
Itgb4 A T 11: 115,984,047 N410I probably benign Het
Jup T C 11: 100,379,601 H360R possibly damaging Het
Kif20b T A 19: 34,974,496 S1685T possibly damaging Het
Lins1 T C 7: 66,712,046 probably null Het
Lrig1 T A 6: 94,607,313 T917S probably benign Het
Mast2 A G 4: 116,311,955 S814P probably damaging Het
Mast4 T C 13: 102,772,519 T483A probably damaging Het
Mcpt1 T C 14: 56,019,533 M176T probably benign Het
Mettl22 A G 16: 8,473,961 Q38R probably damaging Het
Mrm2 T C 5: 140,328,688 T131A probably benign Het
Nde1 T G 16: 14,185,864 F71V probably benign Het
Nxn C T 11: 76,263,187 G274D possibly damaging Het
Olfr1230 A T 2: 89,296,906 Y121* probably null Het
Olfr183 A T 16: 58,999,912 T76S probably benign Het
Olfr414 T A 1: 174,430,643 W72R probably damaging Het
Olfr427 G T 1: 174,099,749 C97F probably damaging Het
Otud7a C A 7: 63,754,629 probably benign Het
Phf3 G A 1: 30,805,940 L1313F probably damaging Het
Pkhd1 A T 1: 20,522,983 D1635E probably benign Het
Plpp1 A G 13: 112,859,664 H171R probably damaging Het
Pofut1 A G 2: 153,261,246 M172V probably damaging Het
Prmt5 A G 14: 54,508,915 F580L probably damaging Het
Rab11fip3 A T 17: 25,991,322 L987Q probably damaging Het
Retnlb T A 16: 48,818,665 C76* probably null Het
Rnf38 T C 4: 44,131,584 N399S probably benign Het
Sbk1 A G 7: 126,292,252 E286G possibly damaging Het
Scin T A 12: 40,077,502 T430S probably benign Het
Sgsm1 T A 5: 113,263,257 T868S probably benign Het
Sipa1l1 G A 12: 82,341,111 R37H probably damaging Het
Smchd1 A T 17: 71,361,837 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Soga1 A T 2: 157,020,448 Y1520* probably null Het
Stk32c C T 7: 139,125,179 R23Q probably damaging Het
Sult1d1 A G 5: 87,564,739 M82T probably benign Het
Tat T C 8: 109,996,918 L346P probably damaging Het
Tenm3 C A 8: 48,310,625 G789V probably damaging Het
Thsd7a C T 6: 12,338,622 S1203N probably benign Het
Tmem191c G A 16: 17,277,962 probably null Het
Tmem268 A G 4: 63,580,338 T239A probably damaging Het
Tmem82 A C 4: 141,616,278 L227R possibly damaging Het
Ttn A T 2: 76,727,032 I29906N probably damaging Het
Txndc15 T C 13: 55,721,574 probably benign Het
Ubqln4 A G 3: 88,565,845 I536V probably benign Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn2r102 A T 17: 19,694,581 I803F probably benign Het
Vmn2r6 G T 3: 64,538,158 Y715* probably null Het
Vmn2r74 A T 7: 85,961,410 C25S probably damaging Het
Wdr38 A G 2: 39,000,979 T261A probably benign Het
Zfp653 T C 9: 22,058,220 E250G possibly damaging Het
Other mutations in Osbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Osbp2 APN 11 3711848 missense probably benign 0.02
IGL00231:Osbp2 APN 11 3726561 missense possibly damaging 0.79
IGL01023:Osbp2 APN 11 3863387 missense probably benign
IGL01819:Osbp2 APN 11 3717127 missense probably damaging 1.00
IGL01931:Osbp2 APN 11 3705388 critical splice donor site probably null
IGL01933:Osbp2 APN 11 3712016 missense probably damaging 1.00
IGL02166:Osbp2 APN 11 3717983 missense probably damaging 1.00
IGL02751:Osbp2 APN 11 3863434 missense probably benign 0.20
IGL02812:Osbp2 APN 11 3714637 missense probably benign 0.00
IGL03289:Osbp2 APN 11 3863380 missense probably benign
3-1:Osbp2 UTSW 11 3863470 missense probably benign 0.11
R0035:Osbp2 UTSW 11 3717997 splice site probably benign
R0109:Osbp2 UTSW 11 3711791 missense probably benign 0.00
R0414:Osbp2 UTSW 11 3819932 missense probably damaging 1.00
R0491:Osbp2 UTSW 11 3714709 missense probably damaging 1.00
R0791:Osbp2 UTSW 11 3711882 splice site probably benign
R1630:Osbp2 UTSW 11 3717167 missense probably benign 0.15
R1931:Osbp2 UTSW 11 3726333 splice site probably null
R2697:Osbp2 UTSW 11 3863407 missense probably benign 0.00
R3799:Osbp2 UTSW 11 3717883 missense probably damaging 1.00
R4700:Osbp2 UTSW 11 3712160 missense probably damaging 1.00
R4718:Osbp2 UTSW 11 3711793 missense probably damaging 0.98
R4788:Osbp2 UTSW 11 3863320 missense probably benign 0.44
R5381:Osbp2 UTSW 11 3705593 missense probably benign 0.12
R5615:Osbp2 UTSW 11 3863356 missense probably benign 0.00
R5681:Osbp2 UTSW 11 3863486 missense probably benign
R6171:Osbp2 UTSW 11 3717221 splice site probably null
R6329:Osbp2 UTSW 11 3715153 missense probably damaging 1.00
R6861:Osbp2 UTSW 11 3715191 missense possibly damaging 0.68
R6987:Osbp2 UTSW 11 3717958 missense probably damaging 0.99
R7205:Osbp2 UTSW 11 3712134 missense probably damaging 1.00
R7316:Osbp2 UTSW 11 3726431 missense probably damaging 1.00
R7540:Osbp2 UTSW 11 3717944 missense probably damaging 0.99
R7559:Osbp2 UTSW 11 3712493 missense probably damaging 1.00
R7830:Osbp2 UTSW 11 3863414 missense probably benign
R8085:Osbp2 UTSW 11 3712521 missense probably damaging 1.00
R9044:Osbp2 UTSW 11 3717128 missense probably damaging 1.00
R9087:Osbp2 UTSW 11 3717976 missense probably damaging 1.00
R9148:Osbp2 UTSW 11 3715143 missense probably damaging 1.00
R9281:Osbp2 UTSW 11 3863375 missense probably benign
R9420:Osbp2 UTSW 11 3712170 missense probably damaging 1.00
R9437:Osbp2 UTSW 11 3714581 missense probably damaging 1.00
X0060:Osbp2 UTSW 11 3820035 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCAAGTGTGCAGATGATCAGAAG -3'
(R):5'- AAAGCTGGGCCTCTGACCAAAC -3'

Sequencing Primer
(F):5'- GGCCAGGTGTAGCCTAAGAAC -3'
(R):5'- GAGTAGAAAAGATGCCCTATCCTCG -3'
Posted On 2014-03-28