Incidental Mutation 'R1473:Drosha'
ID 165951
Institutional Source Beutler Lab
Gene Symbol Drosha
Ensembl Gene ENSMUSG00000022191
Gene Name drosha, ribonuclease type III
Synonyms 1110013A17Rik, Rnasen, Etohi2
MMRRC Submission 039526-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock # R1473 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 12824815-12935291 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 12912520 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1075 (E1075K)
Ref Sequence ENSEMBL: ENSMUSP00000087762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090292] [ENSMUST00000169061]
AlphaFold Q5HZJ0
Predicted Effect probably benign
Transcript: ENSMUST00000090292
AA Change: E1075K

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000087762
Gene: ENSMUSG00000022191
AA Change: E1075K

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121499
Gene: ENSMUSG00000022191
AA Change: E717K

DomainStartEndE-ValueType
low complexity region 115 142 N/A INTRINSIC
SCOP:d1jfza_ 521 545 6e-4 SMART
RIBOc 585 719 1.73e-45 SMART
Blast:RIBOc 729 755 1e-6 BLAST
RIBOc 764 896 1.6e-49 SMART
DSRM 903 975 5.75e-20 SMART
coiled coil region 988 1012 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169061
AA Change: E1075K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000129279
Gene: ENSMUSG00000022191
AA Change: E1075K

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Meta Mutation Damage Score 0.0957 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribonuclease (RNase) III double-stranded RNA-specific ribonuclease and subunit of the microprocessor protein complex, which catalyzes the initial processing step of microRNA (miRNA) synthesis. The encoded protein cleaves the stem loop structure from the primary microRNA (pri-miRNA) in the nucleus, yielding the precursor miRNA (pre-miRNA), which is then exported to the cytoplasm for further processing. In a human cell line lacking a functional copy of this gene, canonical miRNA synthesis is reduced. Somatic mutations in this gene have been observed in human patients with kidney cancer. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice heterozygous for a knock-out allele and a conditional allele activated in the immune system exhibit increased inflammation in multiple systems, cachexia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,068,236 D342G probably damaging Het
Acad8 T C 9: 26,979,041 T293A probably benign Het
Adamts13 C A 2: 26,981,753 Y310* probably null Het
Adcy6 T A 15: 98,592,743 Y1102F probably damaging Het
Ahctf1 G A 1: 179,776,108 T791M probably benign Het
Ahctf1 A G 1: 179,799,279 V18A probably damaging Het
Ampd3 T G 7: 110,804,935 S564R probably damaging Het
Anapc1 A T 2: 128,617,697 I1814K possibly damaging Het
Arl4c A T 1: 88,701,609 L19Q probably damaging Het
Atp6v0e2 T C 6: 48,539,264 Y49H probably damaging Het
Ccdc24 G T 4: 117,869,904 probably benign Het
Clcn6 A C 4: 148,024,156 F139V possibly damaging Het
Col2a1 A G 15: 97,982,908 probably benign Het
Crip2 T A 12: 113,143,500 C29S probably damaging Het
Cyp2a4 A C 7: 26,314,763 N455T probably benign Het
Dhcr7 A G 7: 143,841,368 D113G probably damaging Het
Dhcr7 T C 7: 143,847,068 Y323H probably damaging Het
Dnah7a A C 1: 53,496,014 S2696A probably benign Het
Dnajc12 A G 10: 63,397,244 T55A probably benign Het
Duox2 A G 2: 122,287,121 S911P possibly damaging Het
Ephb2 G A 4: 136,694,058 A327V possibly damaging Het
Espl1 C T 15: 102,320,443 T1711I possibly damaging Het
Fmnl2 A G 2: 52,858,207 K22R possibly damaging Het
Fzd6 T C 15: 39,030,963 F175L probably damaging Het
Gm4737 T A 16: 46,154,819 E65V probably damaging Het
Gm5155 A G 7: 17,905,091 noncoding transcript Het
Gm6526 A G 14: 43,748,846 I76M probably damaging Het
Gm6583 T C 5: 112,354,549 T430A probably benign Het
Gm9881 A T 16: 91,170,735 F34I unknown Het
Gm9892 T C 8: 52,196,614 D148G possibly damaging Het
Grb10 C T 11: 11,934,249 V486I probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hdac4 T C 1: 92,029,968 H108R possibly damaging Het
Hist2h2bb G T 3: 96,270,072 L107F probably damaging Het
Hmcn1 G A 1: 150,772,552 T661I probably benign Het
Icam1 T A 9: 21,027,876 I515N probably damaging Het
Ifi208 A G 1: 173,695,654 R497G possibly damaging Het
Igsf10 A T 3: 59,318,767 V2495E probably damaging Het
Iqgap1 T C 7: 80,734,011 M1102V probably benign Het
Itgb4 A T 11: 115,984,047 N410I probably benign Het
Jup T C 11: 100,379,601 H360R possibly damaging Het
Kif20b T A 19: 34,974,496 S1685T possibly damaging Het
Lins1 T C 7: 66,712,046 probably null Het
Lrig1 T A 6: 94,607,313 T917S probably benign Het
Mast2 A G 4: 116,311,955 S814P probably damaging Het
Mast4 T C 13: 102,772,519 T483A probably damaging Het
Mcpt1 T C 14: 56,019,533 M176T probably benign Het
Mettl22 A G 16: 8,473,961 Q38R probably damaging Het
Mrm2 T C 5: 140,328,688 T131A probably benign Het
Nde1 T G 16: 14,185,864 F71V probably benign Het
Nxn C T 11: 76,263,187 G274D possibly damaging Het
Olfr1230 A T 2: 89,296,906 Y121* probably null Het
Olfr183 A T 16: 58,999,912 T76S probably benign Het
Olfr414 T A 1: 174,430,643 W72R probably damaging Het
Olfr427 G T 1: 174,099,749 C97F probably damaging Het
Osbp2 T C 11: 3,717,175 probably null Het
Otud7a C A 7: 63,754,629 probably benign Het
Phf3 G A 1: 30,805,940 L1313F probably damaging Het
Pkhd1 A T 1: 20,522,983 D1635E probably benign Het
Plpp1 A G 13: 112,859,664 H171R probably damaging Het
Pofut1 A G 2: 153,261,246 M172V probably damaging Het
Prmt5 A G 14: 54,508,915 F580L probably damaging Het
Rab11fip3 A T 17: 25,991,322 L987Q probably damaging Het
Retnlb T A 16: 48,818,665 C76* probably null Het
Rnf38 T C 4: 44,131,584 N399S probably benign Het
Sbk1 A G 7: 126,292,252 E286G possibly damaging Het
Scin T A 12: 40,077,502 T430S probably benign Het
Sgsm1 T A 5: 113,263,257 T868S probably benign Het
Sipa1l1 G A 12: 82,341,111 R37H probably damaging Het
Smchd1 A T 17: 71,361,837 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Soga1 A T 2: 157,020,448 Y1520* probably null Het
Stk32c C T 7: 139,125,179 R23Q probably damaging Het
Sult1d1 A G 5: 87,564,739 M82T probably benign Het
Tat T C 8: 109,996,918 L346P probably damaging Het
Tenm3 C A 8: 48,310,625 G789V probably damaging Het
Thsd7a C T 6: 12,338,622 S1203N probably benign Het
Tmem191c G A 16: 17,277,962 probably null Het
Tmem268 A G 4: 63,580,338 T239A probably damaging Het
Tmem82 A C 4: 141,616,278 L227R possibly damaging Het
Ttn A T 2: 76,727,032 I29906N probably damaging Het
Txndc15 T C 13: 55,721,574 probably benign Het
Ubqln4 A G 3: 88,565,845 I536V probably benign Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn2r102 A T 17: 19,694,581 I803F probably benign Het
Vmn2r6 G T 3: 64,538,158 Y715* probably null Het
Vmn2r74 A T 7: 85,961,410 C25S probably damaging Het
Wdr38 A G 2: 39,000,979 T261A probably benign Het
Zfp653 T C 9: 22,058,220 E250G possibly damaging Het
Other mutations in Drosha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Drosha APN 15 12883194 missense probably damaging 0.99
IGL00736:Drosha APN 15 12833959 missense unknown
IGL00963:Drosha APN 15 12925997 missense probably damaging 0.99
IGL01010:Drosha APN 15 12827289 unclassified probably benign
IGL01340:Drosha APN 15 12834023 intron probably benign
IGL01481:Drosha APN 15 12842439 missense probably benign
IGL01714:Drosha APN 15 12878784 missense probably damaging 1.00
IGL01721:Drosha APN 15 12846112 nonsense probably null
IGL01765:Drosha APN 15 12902680 missense probably damaging 1.00
IGL01893:Drosha APN 15 12866650 splice site probably benign
IGL01944:Drosha APN 15 12889719 missense probably damaging 1.00
IGL02285:Drosha APN 15 12833864 missense unknown
IGL02970:Drosha APN 15 12913956 missense probably damaging 0.98
IGL02990:Drosha APN 15 12827267 unclassified probably benign
IGL03019:Drosha APN 15 12846099 missense probably damaging 1.00
IGL03279:Drosha APN 15 12859392 missense probably benign 0.03
IGL03390:Drosha APN 15 12884983 splice site probably null
tippicanoe UTSW 15 12859465 splice site probably null
Tyler UTSW 15 12861706 missense probably benign 0.45
R0115:Drosha UTSW 15 12846130 missense probably benign 0.15
R0352:Drosha UTSW 15 12837288 missense unknown
R0401:Drosha UTSW 15 12926031 nonsense probably null
R0541:Drosha UTSW 15 12907388 missense probably benign 0.09
R0784:Drosha UTSW 15 12867678 splice site probably benign
R0918:Drosha UTSW 15 12842533 critical splice donor site probably null
R1503:Drosha UTSW 15 12848073 missense probably benign 0.02
R1526:Drosha UTSW 15 12913984 missense probably damaging 1.00
R1809:Drosha UTSW 15 12890112 missense probably null 1.00
R1859:Drosha UTSW 15 12878718 missense probably benign 0.14
R2004:Drosha UTSW 15 12915381 missense probably damaging 0.98
R2060:Drosha UTSW 15 12924159 missense possibly damaging 0.94
R2516:Drosha UTSW 15 12859465 splice site probably null
R3691:Drosha UTSW 15 12834638 missense unknown
R3784:Drosha UTSW 15 12890529 missense possibly damaging 0.82
R3789:Drosha UTSW 15 12912537 nonsense probably null
R3790:Drosha UTSW 15 12912537 nonsense probably null
R4020:Drosha UTSW 15 12837336 missense possibly damaging 0.96
R4817:Drosha UTSW 15 12914047 missense probably damaging 0.97
R4989:Drosha UTSW 15 12935007 missense probably benign 0.05
R5080:Drosha UTSW 15 12842143 missense probably benign 0.01
R5132:Drosha UTSW 15 12837291 missense unknown
R5215:Drosha UTSW 15 12885133 intron probably benign
R5386:Drosha UTSW 15 12842121 missense probably benign
R5457:Drosha UTSW 15 12926029 missense probably benign 0.26
R5536:Drosha UTSW 15 12929711 missense possibly damaging 0.58
R5800:Drosha UTSW 15 12865067 missense probably damaging 1.00
R5800:Drosha UTSW 15 12902647 missense probably damaging 1.00
R5915:Drosha UTSW 15 12935066 missense probably damaging 0.97
R5988:Drosha UTSW 15 12834496 intron probably benign
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6063:Drosha UTSW 15 12834070 intron probably benign
R6391:Drosha UTSW 15 12889717 nonsense probably null
R6492:Drosha UTSW 15 12861706 missense probably benign 0.45
R6799:Drosha UTSW 15 12912537 nonsense probably null
R6870:Drosha UTSW 15 12907393 missense probably benign 0.17
R6920:Drosha UTSW 15 12834310 missense unknown
R7101:Drosha UTSW 15 12865067 missense probably damaging 1.00
R7142:Drosha UTSW 15 12924146 missense possibly damaging 0.70
R7275:Drosha UTSW 15 12846083 missense possibly damaging 0.73
R7337:Drosha UTSW 15 12846199 missense possibly damaging 0.80
R7471:Drosha UTSW 15 12889656 missense probably damaging 1.00
R7538:Drosha UTSW 15 12926243 missense probably damaging 1.00
R7559:Drosha UTSW 15 12842422 missense probably damaging 0.96
R7651:Drosha UTSW 15 12859436 missense probably benign 0.30
R7652:Drosha UTSW 15 12859436 missense probably benign 0.30
R7653:Drosha UTSW 15 12859436 missense probably benign 0.30
R7727:Drosha UTSW 15 12881645 missense probably damaging 1.00
R7780:Drosha UTSW 15 12848086 missense probably benign 0.01
R8068:Drosha UTSW 15 12883190 nonsense probably null
R8283:Drosha UTSW 15 12890501 missense possibly damaging 0.47
R8523:Drosha UTSW 15 12834322 missense unknown
R8985:Drosha UTSW 15 12924101 missense possibly damaging 0.66
R9418:Drosha UTSW 15 12885081 missense probably benign 0.02
R9501:Drosha UTSW 15 12928906 missense probably damaging 1.00
Z1177:Drosha UTSW 15 12842092 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTAATTACAGTCACTACAGGCCG -3'
(R):5'- ATGCTTACCAGGTCACCTGAGCAC -3'

Sequencing Primer
(F):5'- AGTCACTACAGGCCGTTTGAG -3'
(R):5'- TGAAATTTCCCTGACGCCCA -3'
Posted On 2014-03-28