Mutagenetix > Incidental Mutation

Incidental Mutation 'R1473:Espl1'

165955

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

039526-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1473 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 102320443 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1711 (T1711I)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064924
AA Change: T1711I

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: T1711I

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000229050
AA Change: T1711I

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000229942

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230116

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230222

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230617

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231207

Meta Mutation Damage Score

0.1261

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

98% (88/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	T	C	19: 57,068,236	D342G	probably damaging	Het
Acad8	T	C	9: 26,979,041	T293A	probably benign	Het
Adamts13	C	A	2: 26,981,753	Y310*	probably null	Het
Adcy6	T	A	15: 98,592,743	Y1102F	probably damaging	Het
Ahctf1	G	A	1: 179,776,108	T791M	probably benign	Het
Ahctf1	A	G	1: 179,799,279	V18A	probably damaging	Het
Ampd3	T	G	7: 110,804,935	S564R	probably damaging	Het
Anapc1	A	T	2: 128,617,697	I1814K	possibly damaging	Het
Arl4c	A	T	1: 88,701,609	L19Q	probably damaging	Het
Atp6v0e2	T	C	6: 48,539,264	Y49H	probably damaging	Het
Ccdc24	G	T	4: 117,869,904		probably benign	Het
Clcn6	A	C	4: 148,024,156	F139V	possibly damaging	Het
Col2a1	A	G	15: 97,982,908		probably benign	Het
Crip2	T	A	12: 113,143,500	C29S	probably damaging	Het
Cyp2a4	A	C	7: 26,314,763	N455T	probably benign	Het
Dhcr7	A	G	7: 143,841,368	D113G	probably damaging	Het
Dhcr7	T	C	7: 143,847,068	Y323H	probably damaging	Het
Dnah7a	A	C	1: 53,496,014	S2696A	probably benign	Het
Dnajc12	A	G	10: 63,397,244	T55A	probably benign	Het
Drosha	G	A	15: 12,912,520	E1075K	probably benign	Het
Duox2	A	G	2: 122,287,121	S911P	possibly damaging	Het
Ephb2	G	A	4: 136,694,058	A327V	possibly damaging	Het
Fmnl2	A	G	2: 52,858,207	K22R	possibly damaging	Het
Fzd6	T	C	15: 39,030,963	F175L	probably damaging	Het
Gm4737	T	A	16: 46,154,819	E65V	probably damaging	Het
Gm5155	A	G	7: 17,905,091		noncoding transcript	Het
Gm6526	A	G	14: 43,748,846	I76M	probably damaging	Het
Gm6583	T	C	5: 112,354,549	T430A	probably benign	Het
Gm9881	A	T	16: 91,170,735	F34I	unknown	Het
Gm9892	T	C	8: 52,196,614	D148G	possibly damaging	Het
Grb10	C	T	11: 11,934,249	V486I	probably damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Hdac4	T	C	1: 92,029,968	H108R	possibly damaging	Het
Hist2h2bb	G	T	3: 96,270,072	L107F	probably damaging	Het
Hmcn1	G	A	1: 150,772,552	T661I	probably benign	Het
Icam1	T	A	9: 21,027,876	I515N	probably damaging	Het
Ifi208	A	G	1: 173,695,654	R497G	possibly damaging	Het
Igsf10	A	T	3: 59,318,767	V2495E	probably damaging	Het
Iqgap1	T	C	7: 80,734,011	M1102V	probably benign	Het
Itgb4	A	T	11: 115,984,047	N410I	probably benign	Het
Jup	T	C	11: 100,379,601	H360R	possibly damaging	Het
Kif20b	T	A	19: 34,974,496	S1685T	possibly damaging	Het
Lins1	T	C	7: 66,712,046		probably null	Het
Lrig1	T	A	6: 94,607,313	T917S	probably benign	Het
Mast2	A	G	4: 116,311,955	S814P	probably damaging	Het
Mast4	T	C	13: 102,772,519	T483A	probably damaging	Het
Mcpt1	T	C	14: 56,019,533	M176T	probably benign	Het
Mettl22	A	G	16: 8,473,961	Q38R	probably damaging	Het
Mrm2	T	C	5: 140,328,688	T131A	probably benign	Het
Nde1	T	G	16: 14,185,864	F71V	probably benign	Het
Nxn	C	T	11: 76,263,187	G274D	possibly damaging	Het
Olfr1230	A	T	2: 89,296,906	Y121*	probably null	Het
Olfr183	A	T	16: 58,999,912	T76S	probably benign	Het
Olfr414	T	A	1: 174,430,643	W72R	probably damaging	Het
Olfr427	G	T	1: 174,099,749	C97F	probably damaging	Het
Osbp2	T	C	11: 3,717,175		probably null	Het
Otud7a	C	A	7: 63,754,629		probably benign	Het
Phf3	G	A	1: 30,805,940	L1313F	probably damaging	Het
Pkhd1	A	T	1: 20,522,983	D1635E	probably benign	Het
Plpp1	A	G	13: 112,859,664	H171R	probably damaging	Het
Pofut1	A	G	2: 153,261,246	M172V	probably damaging	Het
Prmt5	A	G	14: 54,508,915	F580L	probably damaging	Het
Rab11fip3	A	T	17: 25,991,322	L987Q	probably damaging	Het
Retnlb	T	A	16: 48,818,665	C76*	probably null	Het
Rnf38	T	C	4: 44,131,584	N399S	probably benign	Het
Sbk1	A	G	7: 126,292,252	E286G	possibly damaging	Het
Scin	T	A	12: 40,077,502	T430S	probably benign	Het
Sgsm1	T	A	5: 113,263,257	T868S	probably benign	Het
Sipa1l1	G	A	12: 82,341,111	R37H	probably damaging	Het
Smchd1	A	T	17: 71,361,837		probably benign	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Soga1	A	T	2: 157,020,448	Y1520*	probably null	Het
Stk32c	C	T	7: 139,125,179	R23Q	probably damaging	Het
Sult1d1	A	G	5: 87,564,739	M82T	probably benign	Het
Tat	T	C	8: 109,996,918	L346P	probably damaging	Het
Tenm3	C	A	8: 48,310,625	G789V	probably damaging	Het
Thsd7a	C	T	6: 12,338,622	S1203N	probably benign	Het
Tmem191c	G	A	16: 17,277,962		probably null	Het
Tmem268	A	G	4: 63,580,338	T239A	probably damaging	Het
Tmem82	A	C	4: 141,616,278	L227R	possibly damaging	Het
Ttn	A	T	2: 76,727,032	I29906N	probably damaging	Het
Txndc15	T	C	13: 55,721,574		probably benign	Het
Ubqln4	A	G	3: 88,565,845	I536V	probably benign	Het
Unc80	C	T	1: 66,521,581	H823Y	possibly damaging	Het
Vmn2r102	A	T	17: 19,694,581	I803F	probably benign	Het
Vmn2r6	G	T	3: 64,538,158	Y715*	probably null	Het
Vmn2r74	A	T	7: 85,961,410	C25S	probably damaging	Het
Wdr38	A	G	2: 39,000,979	T261A	probably benign	Het
Zfp653	T	C	9: 22,058,220	E250G	possibly damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATCTTTGTGTGTAGCCCACCTTC -3'
(R):5'- TGGTCCTTCTGGATGGCATCAAAC -3'

Sequencing Primer
(F):5'- GATTTTAGGCGTGAATCACTACCTC -3'
(R):5'- GGATGGCATCAAACTCTTTCAGC -3'

Posted On

2014-03-28