Incidental Mutation 'R1473:Tmem191c'
ID 165958
Institutional Source Beutler Lab
Gene Symbol Tmem191c
Ensembl Gene ENSMUSG00000055692
Gene Name transmembrane protein 191C
Synonyms 4933405M22Rik, D16Bwg1494e, MNCb-4137
MMRRC Submission 039526-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R1473 (G1)
Quality Score 176
Status Validated
Chromosome 16
Chromosomal Location 17276077-17283229 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 17277962 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000069420] [ENSMUST00000069420] [ENSMUST00000159065] [ENSMUST00000159065] [ENSMUST00000159242] [ENSMUST00000159242] [ENSMUST00000159811] [ENSMUST00000159811] [ENSMUST00000161775] [ENSMUST00000161775] [ENSMUST00000164950] [ENSMUST00000164950] [ENSMUST00000232232] [ENSMUST00000232364]
AlphaFold Q9JJB1
Predicted Effect probably benign
Transcript: ENSMUST00000036161
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect probably null
Transcript: ENSMUST00000069420
SMART Domains Protein: ENSMUSP00000068902
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 121 3.1e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000069420
SMART Domains Protein: ENSMUSP00000068902
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 121 3.1e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148110
Predicted Effect probably null
Transcript: ENSMUST00000159065
SMART Domains Protein: ENSMUSP00000123791
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 121 3.1e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159065
SMART Domains Protein: ENSMUSP00000123791
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 121 3.1e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159242
SMART Domains Protein: ENSMUSP00000124757
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 121 3.1e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159242
SMART Domains Protein: ENSMUSP00000124757
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 121 3.1e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159811
SMART Domains Protein: ENSMUSP00000123710
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 121 3.1e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159811
SMART Domains Protein: ENSMUSP00000123710
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 121 3.1e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160949
Predicted Effect probably null
Transcript: ENSMUST00000161775
SMART Domains Protein: ENSMUSP00000123917
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 121 3.1e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161775
SMART Domains Protein: ENSMUSP00000123917
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 121 3.1e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162344
Predicted Effect probably null
Transcript: ENSMUST00000164950
SMART Domains Protein: ENSMUSP00000131127
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
coiled coil region 5 112 N/A INTRINSIC
Pfam:TMEM191C 182 302 1.5e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164950
SMART Domains Protein: ENSMUSP00000131127
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
coiled coil region 5 112 N/A INTRINSIC
Pfam:TMEM191C 182 302 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231322
Predicted Effect probably benign
Transcript: ENSMUST00000232232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232631
Predicted Effect probably benign
Transcript: ENSMUST00000232167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232071
Predicted Effect probably benign
Transcript: ENSMUST00000232364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232426
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 98% (88/90)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,068,236 D342G probably damaging Het
Acad8 T C 9: 26,979,041 T293A probably benign Het
Adamts13 C A 2: 26,981,753 Y310* probably null Het
Adcy6 T A 15: 98,592,743 Y1102F probably damaging Het
Ahctf1 G A 1: 179,776,108 T791M probably benign Het
Ahctf1 A G 1: 179,799,279 V18A probably damaging Het
Ampd3 T G 7: 110,804,935 S564R probably damaging Het
Anapc1 A T 2: 128,617,697 I1814K possibly damaging Het
Arl4c A T 1: 88,701,609 L19Q probably damaging Het
Atp6v0e2 T C 6: 48,539,264 Y49H probably damaging Het
Ccdc24 G T 4: 117,869,904 probably benign Het
Clcn6 A C 4: 148,024,156 F139V possibly damaging Het
Col2a1 A G 15: 97,982,908 probably benign Het
Crip2 T A 12: 113,143,500 C29S probably damaging Het
Cyp2a4 A C 7: 26,314,763 N455T probably benign Het
Dhcr7 A G 7: 143,841,368 D113G probably damaging Het
Dhcr7 T C 7: 143,847,068 Y323H probably damaging Het
Dnah7a A C 1: 53,496,014 S2696A probably benign Het
Dnajc12 A G 10: 63,397,244 T55A probably benign Het
Drosha G A 15: 12,912,520 E1075K probably benign Het
Duox2 A G 2: 122,287,121 S911P possibly damaging Het
Ephb2 G A 4: 136,694,058 A327V possibly damaging Het
Espl1 C T 15: 102,320,443 T1711I possibly damaging Het
Fmnl2 A G 2: 52,858,207 K22R possibly damaging Het
Fzd6 T C 15: 39,030,963 F175L probably damaging Het
Gm4737 T A 16: 46,154,819 E65V probably damaging Het
Gm5155 A G 7: 17,905,091 noncoding transcript Het
Gm6526 A G 14: 43,748,846 I76M probably damaging Het
Gm6583 T C 5: 112,354,549 T430A probably benign Het
Gm9881 A T 16: 91,170,735 F34I unknown Het
Gm9892 T C 8: 52,196,614 D148G possibly damaging Het
Grb10 C T 11: 11,934,249 V486I probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hdac4 T C 1: 92,029,968 H108R possibly damaging Het
Hist2h2bb G T 3: 96,270,072 L107F probably damaging Het
Hmcn1 G A 1: 150,772,552 T661I probably benign Het
Icam1 T A 9: 21,027,876 I515N probably damaging Het
Ifi208 A G 1: 173,695,654 R497G possibly damaging Het
Igsf10 A T 3: 59,318,767 V2495E probably damaging Het
Iqgap1 T C 7: 80,734,011 M1102V probably benign Het
Itgb4 A T 11: 115,984,047 N410I probably benign Het
Jup T C 11: 100,379,601 H360R possibly damaging Het
Kif20b T A 19: 34,974,496 S1685T possibly damaging Het
Lins1 T C 7: 66,712,046 probably null Het
Lrig1 T A 6: 94,607,313 T917S probably benign Het
Mast2 A G 4: 116,311,955 S814P probably damaging Het
Mast4 T C 13: 102,772,519 T483A probably damaging Het
Mcpt1 T C 14: 56,019,533 M176T probably benign Het
Mettl22 A G 16: 8,473,961 Q38R probably damaging Het
Mrm2 T C 5: 140,328,688 T131A probably benign Het
Nde1 T G 16: 14,185,864 F71V probably benign Het
Nxn C T 11: 76,263,187 G274D possibly damaging Het
Olfr1230 A T 2: 89,296,906 Y121* probably null Het
Olfr183 A T 16: 58,999,912 T76S probably benign Het
Olfr414 T A 1: 174,430,643 W72R probably damaging Het
Olfr427 G T 1: 174,099,749 C97F probably damaging Het
Osbp2 T C 11: 3,717,175 probably null Het
Otud7a C A 7: 63,754,629 probably benign Het
Phf3 G A 1: 30,805,940 L1313F probably damaging Het
Pkhd1 A T 1: 20,522,983 D1635E probably benign Het
Plpp1 A G 13: 112,859,664 H171R probably damaging Het
Pofut1 A G 2: 153,261,246 M172V probably damaging Het
Prmt5 A G 14: 54,508,915 F580L probably damaging Het
Rab11fip3 A T 17: 25,991,322 L987Q probably damaging Het
Retnlb T A 16: 48,818,665 C76* probably null Het
Rnf38 T C 4: 44,131,584 N399S probably benign Het
Sbk1 A G 7: 126,292,252 E286G possibly damaging Het
Scin T A 12: 40,077,502 T430S probably benign Het
Sgsm1 T A 5: 113,263,257 T868S probably benign Het
Sipa1l1 G A 12: 82,341,111 R37H probably damaging Het
Smchd1 A T 17: 71,361,837 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Soga1 A T 2: 157,020,448 Y1520* probably null Het
Stk32c C T 7: 139,125,179 R23Q probably damaging Het
Sult1d1 A G 5: 87,564,739 M82T probably benign Het
Tat T C 8: 109,996,918 L346P probably damaging Het
Tenm3 C A 8: 48,310,625 G789V probably damaging Het
Thsd7a C T 6: 12,338,622 S1203N probably benign Het
Tmem268 A G 4: 63,580,338 T239A probably damaging Het
Tmem82 A C 4: 141,616,278 L227R possibly damaging Het
Ttn A T 2: 76,727,032 I29906N probably damaging Het
Txndc15 T C 13: 55,721,574 probably benign Het
Ubqln4 A G 3: 88,565,845 I536V probably benign Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn2r102 A T 17: 19,694,581 I803F probably benign Het
Vmn2r6 G T 3: 64,538,158 Y715* probably null Het
Vmn2r74 A T 7: 85,961,410 C25S probably damaging Het
Wdr38 A G 2: 39,000,979 T261A probably benign Het
Zfp653 T C 9: 22,058,220 E250G possibly damaging Het
Other mutations in Tmem191c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:Tmem191c APN 16 17277730 missense possibly damaging 0.95
IGL03146:Tmem191c APN 16 17277382 missense probably damaging 0.96
R1037:Tmem191c UTSW 16 17276483 unclassified probably benign
R1551:Tmem191c UTSW 16 17278120 missense probably damaging 0.97
R5070:Tmem191c UTSW 16 17277695 missense probably null 0.99
R5161:Tmem191c UTSW 16 17276879 missense possibly damaging 0.93
R5987:Tmem191c UTSW 16 17276470 critical splice donor site probably null
R6696:Tmem191c UTSW 16 17283022 splice site probably null
R9185:Tmem191c UTSW 16 17276438 missense probably damaging 0.98
R9358:Tmem191c UTSW 16 17276393 missense probably damaging 0.96
R9424:Tmem191c UTSW 16 17276662 nonsense probably null
R9576:Tmem191c UTSW 16 17276662 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCGGAACCGTAAGAATTGGGAC -3'
(R):5'- ACGCAGCTCAAGTAAAGGCGAC -3'

Sequencing Primer
(F):5'- TGGAACTCAGAGCCTCGTC -3'
(R):5'- GACAGCGTGTAGCGCAG -3'
Posted On 2014-03-28