Incidental Mutation 'R1473:Olfr183'
ID 165961
Institutional Source Beutler Lab
Gene Symbol Olfr183
Ensembl Gene ENSMUSG00000062105
Gene Name olfactory receptor 183
Synonyms MOR183-2, GA_x54KRFPKG5P-55229158-55230087
MMRRC Submission 039526-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R1473 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 58995357-59001441 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58999912 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 76 (T76S)
Ref Sequence ENSEMBL: ENSMUSP00000149279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073320] [ENSMUST00000206303] [ENSMUST00000213465] [ENSMUST00000214831] [ENSMUST00000214916]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000073320
AA Change: T76S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080602
Gene: ENSMUSG00000062105
AA Change: T76S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-48 PFAM
Pfam:7tm_1 41 290 4.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206303
AA Change: T76S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000213465
AA Change: T76S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000214831
AA Change: T76S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000214916
AA Change: T76S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1766 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,068,236 D342G probably damaging Het
Acad8 T C 9: 26,979,041 T293A probably benign Het
Adamts13 C A 2: 26,981,753 Y310* probably null Het
Adcy6 T A 15: 98,592,743 Y1102F probably damaging Het
Ahctf1 G A 1: 179,776,108 T791M probably benign Het
Ahctf1 A G 1: 179,799,279 V18A probably damaging Het
Ampd3 T G 7: 110,804,935 S564R probably damaging Het
Anapc1 A T 2: 128,617,697 I1814K possibly damaging Het
Arl4c A T 1: 88,701,609 L19Q probably damaging Het
Atp6v0e2 T C 6: 48,539,264 Y49H probably damaging Het
Ccdc24 G T 4: 117,869,904 probably benign Het
Clcn6 A C 4: 148,024,156 F139V possibly damaging Het
Col2a1 A G 15: 97,982,908 probably benign Het
Crip2 T A 12: 113,143,500 C29S probably damaging Het
Cyp2a4 A C 7: 26,314,763 N455T probably benign Het
Dhcr7 A G 7: 143,841,368 D113G probably damaging Het
Dhcr7 T C 7: 143,847,068 Y323H probably damaging Het
Dnah7a A C 1: 53,496,014 S2696A probably benign Het
Dnajc12 A G 10: 63,397,244 T55A probably benign Het
Drosha G A 15: 12,912,520 E1075K probably benign Het
Duox2 A G 2: 122,287,121 S911P possibly damaging Het
Ephb2 G A 4: 136,694,058 A327V possibly damaging Het
Espl1 C T 15: 102,320,443 T1711I possibly damaging Het
Fmnl2 A G 2: 52,858,207 K22R possibly damaging Het
Fzd6 T C 15: 39,030,963 F175L probably damaging Het
Gm4737 T A 16: 46,154,819 E65V probably damaging Het
Gm5155 A G 7: 17,905,091 noncoding transcript Het
Gm6526 A G 14: 43,748,846 I76M probably damaging Het
Gm6583 T C 5: 112,354,549 T430A probably benign Het
Gm9881 A T 16: 91,170,735 F34I unknown Het
Gm9892 T C 8: 52,196,614 D148G possibly damaging Het
Grb10 C T 11: 11,934,249 V486I probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hdac4 T C 1: 92,029,968 H108R possibly damaging Het
Hist2h2bb G T 3: 96,270,072 L107F probably damaging Het
Hmcn1 G A 1: 150,772,552 T661I probably benign Het
Icam1 T A 9: 21,027,876 I515N probably damaging Het
Ifi208 A G 1: 173,695,654 R497G possibly damaging Het
Igsf10 A T 3: 59,318,767 V2495E probably damaging Het
Iqgap1 T C 7: 80,734,011 M1102V probably benign Het
Itgb4 A T 11: 115,984,047 N410I probably benign Het
Jup T C 11: 100,379,601 H360R possibly damaging Het
Kif20b T A 19: 34,974,496 S1685T possibly damaging Het
Lins1 T C 7: 66,712,046 probably null Het
Lrig1 T A 6: 94,607,313 T917S probably benign Het
Mast2 A G 4: 116,311,955 S814P probably damaging Het
Mast4 T C 13: 102,772,519 T483A probably damaging Het
Mcpt1 T C 14: 56,019,533 M176T probably benign Het
Mettl22 A G 16: 8,473,961 Q38R probably damaging Het
Mrm2 T C 5: 140,328,688 T131A probably benign Het
Nde1 T G 16: 14,185,864 F71V probably benign Het
Nxn C T 11: 76,263,187 G274D possibly damaging Het
Olfr1230 A T 2: 89,296,906 Y121* probably null Het
Olfr414 T A 1: 174,430,643 W72R probably damaging Het
Olfr427 G T 1: 174,099,749 C97F probably damaging Het
Osbp2 T C 11: 3,717,175 probably null Het
Otud7a C A 7: 63,754,629 probably benign Het
Phf3 G A 1: 30,805,940 L1313F probably damaging Het
Pkhd1 A T 1: 20,522,983 D1635E probably benign Het
Plpp1 A G 13: 112,859,664 H171R probably damaging Het
Pofut1 A G 2: 153,261,246 M172V probably damaging Het
Prmt5 A G 14: 54,508,915 F580L probably damaging Het
Rab11fip3 A T 17: 25,991,322 L987Q probably damaging Het
Retnlb T A 16: 48,818,665 C76* probably null Het
Rnf38 T C 4: 44,131,584 N399S probably benign Het
Sbk1 A G 7: 126,292,252 E286G possibly damaging Het
Scin T A 12: 40,077,502 T430S probably benign Het
Sgsm1 T A 5: 113,263,257 T868S probably benign Het
Sipa1l1 G A 12: 82,341,111 R37H probably damaging Het
Smchd1 A T 17: 71,361,837 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Soga1 A T 2: 157,020,448 Y1520* probably null Het
Stk32c C T 7: 139,125,179 R23Q probably damaging Het
Sult1d1 A G 5: 87,564,739 M82T probably benign Het
Tat T C 8: 109,996,918 L346P probably damaging Het
Tenm3 C A 8: 48,310,625 G789V probably damaging Het
Thsd7a C T 6: 12,338,622 S1203N probably benign Het
Tmem191c G A 16: 17,277,962 probably null Het
Tmem268 A G 4: 63,580,338 T239A probably damaging Het
Tmem82 A C 4: 141,616,278 L227R possibly damaging Het
Ttn A T 2: 76,727,032 I29906N probably damaging Het
Txndc15 T C 13: 55,721,574 probably benign Het
Ubqln4 A G 3: 88,565,845 I536V probably benign Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn2r102 A T 17: 19,694,581 I803F probably benign Het
Vmn2r6 G T 3: 64,538,158 Y715* probably null Het
Vmn2r74 A T 7: 85,961,410 C25S probably damaging Het
Wdr38 A G 2: 39,000,979 T261A probably benign Het
Zfp653 T C 9: 22,058,220 E250G possibly damaging Het
Other mutations in Olfr183
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02294:Olfr183 APN 16 59000065 missense probably damaging 1.00
IGL02795:Olfr183 APN 16 59000277 missense possibly damaging 0.73
IGL02803:Olfr183 APN 16 58999958 missense probably benign 0.33
IGL02837:Olfr183 UTSW 16 59000546 missense probably damaging 1.00
R0045:Olfr183 UTSW 16 59000491 missense probably benign 0.00
R0372:Olfr183 UTSW 16 59000087 missense probably benign 0.03
R0652:Olfr183 UTSW 16 58999700 missense probably damaging 0.99
R0890:Olfr183 UTSW 16 58999787 missense possibly damaging 0.94
R1279:Olfr183 UTSW 16 59000138 missense possibly damaging 0.94
R1429:Olfr183 UTSW 16 59000138 missense possibly damaging 0.94
R2115:Olfr183 UTSW 16 59000420 missense possibly damaging 0.50
R2117:Olfr183 UTSW 16 59000420 missense possibly damaging 0.50
R4508:Olfr183 UTSW 16 58999775 missense probably benign 0.26
R4709:Olfr183 UTSW 16 59000095 missense probably benign 0.01
R4929:Olfr183 UTSW 16 59000219 missense probably damaging 1.00
R5478:Olfr183 UTSW 16 59000062 missense possibly damaging 0.88
R5522:Olfr183 UTSW 16 58999905 missense probably benign 0.22
R5571:Olfr183 UTSW 16 59000206 missense probably benign 0.02
R5685:Olfr183 UTSW 16 59000346 missense probably benign
R6064:Olfr183 UTSW 16 58999823 missense probably damaging 0.99
R7443:Olfr183 UTSW 16 58999990 missense probably damaging 0.96
R7870:Olfr183 UTSW 16 58999723 missense probably benign 0.00
R8085:Olfr183 UTSW 16 59000069 missense probably benign 0.02
R8459:Olfr183 UTSW 16 58999985 missense probably damaging 1.00
R9177:Olfr183 UTSW 16 58999720 missense probably damaging 0.99
R9268:Olfr183 UTSW 16 58999720 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCTACCACAGTGGAAACCTCTC -3'
(R):5'- GTCTACTTCTGAAGATGCAGGGTGC -3'

Sequencing Primer
(F):5'- ACAGTGGAAACCTCTCCTATTC -3'
(R):5'- GGCGAACACATAATCTATTGGTC -3'
Posted On 2014-03-28